Labshake search
Citations for Qiagen :
2901 - 2950 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the RNeasy Mini kit (Qiagen). A sample for microinjection was prepared by mixing two guide RNAs in water (25 ng/μl for each ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNAs were extracted using RNeasy Mini Kit (Qiagen) and infection confirmed using RT-qPCR quantification of viral RNAs using specific primers pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the miRCURY LNA RT Kit (Qiagen, UK) was used to conduct qPCR in the Roche ® LightCycler® 480 according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... with QuantiTech SYBR Green PCR kit (Qiagen, 204141). The PCR protocol involved warming-up at 50°C for 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... using a QuantiNova Probe PCR Kit (Qiagen, 208254) following the kit protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Neuroscience 2024Quote: ... containing a Lysis buffer ((RNeasy Micro Kit (Qiagen)) ...
-
bioRxiv - Molecular Biology 2024Quote: DNA extraction with EZ1 DNA Investigator kit (Qiagen) was performed according to the manufacturer’s instructions and the large volume protocol [31] ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using the RNeasy Mini Kit (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA isolation kit (Qiagen DNeasy, Hilden, Germany) was used to isolate sperm genomic DNA according to the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNeasy® Plus Universal Mini Kit (Qiagen, Germany) was used to extract the total RNA ...
-
bioRxiv - Immunology 2024Quote: ... Following purification with the PCR Purification Kit (QIAGEN), fragment sizes were confirmed using the 2200 TapeStation and High Sensitivity D1000 ScreenTapes (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was isolated using an RNeasy kit (Qiagen) and reverse transcription was performed with the Quantitect kit (QIAGEN) ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated using RNeasy Micro Kit (QIAGEN) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... was isolated using DNeasy Blood & Tissue Kit (QIAGEN) according to manufacturer’s protocol and normalized using NanoDrop (ThermoFischer Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... the QIAamp BiOstic Bacteremia DNA Kit (Qiagen, Germany), DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... miRCURY LNA SYBR® Green PCR Kit (Qiagen) was used for QRT-PCR according to manufacturer instructions and as described in (5).
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated using RNeasy micro kit (Qiagen) and RNA was converted to cDNA using Superscript III reverse transcriptase (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... anophelis or ZIKV/DMEM using RNeasy kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Organoid RNA was isolated using RNAeasy kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cleaned-up using the RNeasy kit (Qiagen, UK) and cDNA was synthesized with the High Capacity cDNA Transcription kit (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... and concentrated using a PCR purification kit (Qiagen). 3 µl of 10 µM stock tracRNA (IDT ...
-
bioRxiv - Bioengineering 2024Quote: ... or Qiagen DNeasy Powersoil Pro Kit (47016; Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... by using a miRNeasy Mini Kit (217004, Qiagen). We confirmed whether total RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNA was extracted using RNeasy Kits (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using the RNeasy Mini Kit (QIAGEN). sfGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... and RNA extracted using RNeasy Mini Kit (Qiagen). Number of biological replicates per library ranged between RNA quality was assessed using Tape station High Sensitivity RNA assay (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... RNeasy Mini Kit was from Qiagen (Germantown, MD). Permafluor ...
-
bioRxiv - Neuroscience 2024Quote: ... using the QuantiTect Reverse Transcription kit (205311, Qiagen). DNA templates were amplified with the following PCR primers ...
-
bioRxiv - Genetics 2024Quote: ... RNA was extracted with RNeasy mini kit (Qiagen) followed by reverse transcription using the Fastquant RT kit (Tiangen) ...
-
bioRxiv - Cell Biology 2024Quote: ... and RNA was extracted using RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Was done using an miRNeasy Mini kit (Qiagen) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and gel purified (QIAquick Gel Extraction Kit; Qiagen) and transformed into DH5α competent cells (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... using DNeasy Blood & Tissue Kit (Qiagen, Germany, Hilden) with some modification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... either using the QIAquick Gel Extraction kit (Qiagen) or by soaking the plugs overnight in 100 ul nuclease-free water at 4 °C followed by 1 h at −80 °C and recovered at 23,000 x g ...
-
bioRxiv - Developmental Biology 2024Quote: ... using QuantiNova SYBR Green PCR Kit (208054, Qiagen). All primer sequences are shown in Supplementary Table 1 ...
-
bioRxiv - Genetics 2024Quote: ... Purification with the QIAquick PCR purification Kit (Qiagen) was followed to proceed with the PCR amplification step ...
-
bioRxiv - Genomics 2024Quote: ... using the AllPrep DNA/RNA mini kit (Qiagen). Poly-A RNA was isolated using Dynabeads oligo(dT)25 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and RNeasy Mini kit (QIAGEN Cat. No. 74104), respectively ...
-
bioRxiv - Microbiology 2024Quote: RNA extraction was performed using RNeasy Kit (Qiagen) according to supplier’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... coli using the QIAprep Spin Miniprep Kit (Qiagen). All plasmids made by PCR cloning were sequenced by Azenta ...
-
bioRxiv - Immunology 2024Quote: ... miRNeasy Mini kit for RNA isolation (Qiagen 217004), and nuclease-free water (Life Technologies AM9937 ...
-
bioRxiv - Immunology 2024Quote: ... Shank3b+/+ mice using RNeasy Plus Mini Kit (Qiagen), and retro-transcribed to cDNA as reported in our previous work (12,43) ...
-
bioRxiv - Immunology 2024Quote: ... and purification with an RNeasy purification kit (Qiagen). Recombinant WT SARS-CoV-2 full-length S protein and RBD (aa319-545 ...
-
bioRxiv - Cell Biology 2024Quote: RNAs were extracted with RNAeasy mini kit (Qiagen) including DNase treatment ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted using the RNeasy Kit (Qiagen); library generation and subsequent sequencing was performed by the clinical genomics lab (CGL ...
-
bioRxiv - Cancer Biology 2024Quote: Standard protocols from the miRNeasy Mini kit (Qiagen) was used to extract total RNA with the inclusion of on-column genomic DNA digestion step using the RNase-free DNase Kit (Qaigen) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted using an Rneasy Kit (Qiagen), and reverse-transcribed with the Lunascript Reverse Transcription kit (New England Biolab ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by the Qiaprep Spin Miniprep Kit (Qiagen). Genomic DNA was isolated via the GeneJet Genomic DNA Purification Kit (Thermo Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... For cRNA purification the RNeasy Mini Kit (QIAGEN) was used ...