Labshake search
Citations for Qiagen :
2801 - 2850 of 3263 citations for 2 3 5 Dioxo 4 aza tricyclo 5.2.1.0*2 6* dec 8 en 4 yl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... the resulting dried leaves were then ground to powder with a 3-mm glass bead placed in a tube with a Tissuelyser mill (Qiagen). The ground samples were incubated at 4°C in DNA extraction buffer (200 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from 2000 cells per replicate and 3 replicates per treatment by the micro RNeasy kit (QIAGEN) for both mouse muscle satellite cells and ZeMPCs ...
-
bioRxiv - Genetics 2022Quote: RNA from cortex and hippocampus derived ex vivo cultures was extracted from 3 biological replicates for three time points (DIV3, DIV15, DIV31) using RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using a SuperScript IV Reverse Transcriptase cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Genetics 2024Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, pr-set720 and parp-1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final samples of 3 or 30 million cells were collected and genomic DNA was extracted (DNeasy blood and Tissue kit, Qiagen). Next ...
-
bioRxiv - Plant Biology 2024Quote: ... roots or cotyledons) of 3 DAG Arabidopsis seedlings was flash frozen in liquid nitrogen and powdered with TissueLyser machine (Qiagen). RNA was isolated with TRIzol (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: To determine bispecificity of bsAbs his-tagged HCV E2 (3 μg/mL in Tris-buffered saline (TBS)) was immobilized on NiNTA 96-well plates (Qiagen) for 2h at RT ...
-
bioRxiv - Immunology 2024Quote: Reverse transcription and PCR I were performed in 384-well plates pre-loaded with 3 µL of Vapor-Lock (Qiagen). Cell lysis buffer and reverse transcriptase mix (0.4 µL/well ...
-
bioRxiv - Biochemistry 2024Quote: ... NEO1 3’UTR was isolated from genomic DNA isolated from cultured HEK-293T using DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting homogenates were centrifuged at 13,000 rotations per minute (rpm) for 3 min and RNA in the supernatant was purified using the RNase Mini Kit (Qiagen). A NanoDrop spectrophotometer was used to measure the concentration of RNA in each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were diluted in TE buffer and treated with 1 μL of 20 mg/mL RNAse A (Applichem) for 1 h and 3 μL of Proteinase K (Qiagen) for 2 h at 40C ...
-
bioRxiv - Molecular Biology 2024Quote: ... ligated with a single-stranded phosphorylated oligo (to create a 3’-end overhang on template strand) and purified using PCR purification kit (Qiagen). Sequences are listed in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: ... plasmids containing spacer sequences were isolated from 3 mL of overnight culture from each sample with a QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Genomic DNA was extracted from 3 mm rings surrounding the initial punch wound using DNeasy Blood and Tissue kit (Qiagen). The tissues from a pair of ear pinnae from each animal were pooled prior to DNA extraction so that each DNA sample represented one mouse ...
-
bioRxiv - Biophysics 2024Quote: ... 1.0 mL of culture was extracted from each tube and mixed with 3 mL of RNAprotect Bacteria reagent (Qiagen, Germany) to stabilize cellular RNA ...
-
bioRxiv - Genomics 2021Quote: ... The eluates were mixed with guanidine– HCl to a final concentration of 6 M and incubated with Ni-NTA sepharose (Qiagen, 100 μl of slurry per sample) o/n at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Immunology 2020Quote: ... The bacterial lysates were mixed for 1 h with 5 ml of Ni-NTA resin (Qiagen) that had been equilibrated with buffer A ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 mM Tris pH 8.0) using 5 mM stainless steel beads in a TissueLyser II (Qiagen). In vitro TPP1 assay was performed as described ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified lysate was applied to two tandemly-connected 5 ml Ni-NTA Superflow cartridges (Qiagen); the cartridges were washed with buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated in 0.08 M KOH for 5 min and washed by Buffer EB (Qiagen). Then ...
-
bioRxiv - Microbiology 2020Quote: ... The proteolysis reaction products were then passed over a 5 mL Ni-NTA superflow cartridge (Qiagen) to remove TEV and uncleaved protein ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.8□l of forward and reverse primer at 5□M concentration and 10□l QuantiNova (Qiagen), made up to a final volume of 20□l with nuclease-free water ...
-
bioRxiv - Microbiology 2024Quote: ... One µg of purified RNA was treated twice with 5 µl of RNAse-free DNAse (Qiagen) and subjected to a final on column purification ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Each reaction contained 5 μL DNA solution and PCR mixture with Taq Type-it (Qiagen®). PCR products were analyzed by capillarity electrophoresis on an ABl3130xl sequencer ...
-
bioRxiv - Microbiology 2024Quote: ... cell pellets were resuspended in lysis buffer (250 μL 1X PBS + 5 μL lytic enzyme (Qiagen) per sample ...
-
bioRxiv - Microbiology 2024Quote: ... cell pellets were resuspended in lysis buffer (250 μL 1X PBS + 5 μL lytic enzyme (Qiagen) per sample ...