Labshake search
Citations for Qiagen :
2701 - 2750 of 10000+ citations for Creatinine Serum Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Pathology 2023Quote: ... tissue and cells were lysed in RIPA lysis buffer supplemented with orthovanadate and a cocktail of protease inhibitors at 4°C (using a TissueLyser (Qiagen) to homogenize liver tissue ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1 h in 50 mL conical tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting samples were supplemented with 300 mM NaCl and 10 mM imidazole and incubated overnight at 4 °C on a stirring wheel with 50 µl Ni-NTA agarose resin slurry (QIAGEN) pre-equilibrated with wash buffer I (50 mM Tris-HCl pH 7.8 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysates were centrifuged at 10000 g for 30 min at 4 °C and the clear supernatant was collected and passed through Ni-NTA agarose column (Qiagen). Contaminating proteins were washed away by passing a 20–120 mM imidazole gradient through the column while the bound toxins were eluted using PBS containing 500 mM imidazole ...
-
bioRxiv - Microbiology 2019Quote: ... Influenza virus nucleic load was determined by qRT-PCR using influenza virus segment M specific primers (IAV-M; Table. 1) in 96-well plates according to the manufacturer instructions (OneStep RT-PCR, Qiagen, Toronto, Canada). Absolute quantification was performed using a standard curve based on a 10-fold serial dilution of a plasmid containing the A/Guinea Fowl/129/2015(H5N9 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One million cells per well were seeded in 6 well plates in 2 mL growth medium the day before transfection and transfected with PolyFect (Qiagen, Düsseldorf, DE) using the manufacturers protocol (changing the medium to growth medium without hygromycin B and puromycin prior to transfection) ...
-
bioRxiv - Microbiology 2021Quote: ... ethanol-stored flies were rehydrated in water and transferred to 1.5 ml well plates for homogenisation using a bead beater (Qiagen Tissue Lyzer II). Protein was digested using Proteinase K ...
-
bioRxiv - Microbiology 2020Quote: ... bearing a C-terminal histidine tag (ACRO Biosystems, Newark, NJ) was coated at 2 μg/ml on a Ni-NTA plate (Qiagen, Valencia, CA). After washing and blocking ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.4×106 S2R+ cells were seeded in 6-well plates and were transfected with 1 μg of each pMK33-ARRDC-GFP construct using Effectene transfection reagent (#301425, Qiagen, Venlo, Netherlands). pMK33 plasmid is a copper-induced protein expression vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... collected into 96-well plates (on ice) prior to the addition of 10 μL of RLT plus lysis buffer (Qiagen, Hilden, Germany). All instruments and surfaces were cleaned with 80% v/v ethanol ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... First strand cDNA was synthesized from 0.5 mg of total RNA using QIAGEN RT2 First Strand Kits and transcripts for mouse cytokines and chemokines were quantified using qPCR microarrays comprising 96-well plates precoated with primers (QIAGEN PAMM-150Z). Each 96-well plate also contained primers for 5 housekeeping genes as well as positive and negative controls ...
-
bioRxiv - Immunology 2021Quote: The ipsilateral hemispheres were lysed in Qiazol Lysis Reagent and total RNA was extracted using the MaXtract High Density kit with further purification using the RNeasy Mini Kit (all Qiagen). 70 ng of total RNA per sample was then hybridized with reporter and capture probes for nCounter Gene Expression code sets (Mouse Neuroinflammation codeset ...
-
bioRxiv - Genetics 2021Quote: ... Cells were lysed with Precellys CKMix Tissue Homogenizing Kit (Bertin Technologies) and total RNA was extracted using Qiagen RNeasy Maxi Kit (Qiagen).
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from lung homogenates according to the instructions of the RNA extraction kit manufacturer (RNeasy Plus Mini Kit; Qiagen) post phase separation using Trizol reagent ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from lung homogenates according to the instructions of the RNA extraction kit manufacturer (RNeasy Plus Mini Kit; Qiagen) post phase separation using Trizol reagent ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA extraction was done using RNeasy Plus Mini Kit following Proteinase K digestion and elimination of DNases using RNase-free DNase kit (all reagents from Qiagen). Isolated RNA was then converted to cDNA using Bio-Rad iScript kit and RT-qPCR using Bio-Rad SYBR Sso Advanced ...
-
bioRxiv - Genetics 2019Quote: ... gDNA was extracted from dried blood spots and whole-genome amplified using QIAmp DNA Mini kits and Replica-G Midi amplification kits (Qiagen), respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... DNA and RNA were extracted from sections of the frozen tissue using the QIAamp DNA Mini Kit and RNeasy Mini Kit (Qiagen), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was performed using bead-bound RNA (SuperScript VILO cDNA synthesis kit) and qPCR was performed in triplicate (QuantiFast SYBR Green PCR Kit; Qiagen) on a Roche LightCycler 480 using beta-actin as reference gene ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA extraction and cDNA synthesis were performed the following day using QIAamp RNA Blood Mini Kit and cDNA Synthesis Kit respectively (Qiagen), and then stored at −80°C until assayed ...
-
bioRxiv - Microbiology 2020Quote: ... RNA extraction was performed using the QIAamp 96 DNA kit and the Qiacube HT kit and the Qiacube HT (both from Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RNA was removed using NaOH hydrolysis and cDNA was purified using the buffers from the QIAquick Nucleotide Removal Kit and the columns from the MinElute Reaction Cleanup Kit (Qiagen). Finally ...
-
bioRxiv - Genomics 2019Quote: Genomic DNA was extracted from the caudal fin of each challenged fish using the DNeasy Blood & Kit tissue kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA fragments were extracted from agarose gels using the QIAquick gel extraction kit and from liquids using the QIAquick PCR purification kit (QIAGEN). Plasmid DNA was isolated using the Wizard Plus SV Minipreps DNA purification kit (Promega ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We extracted total genomic DNA from blood and/or tissue samples using standard nucleic acid extraction kits (QIAamp DNA Mini Kit; Qiagen) automated on a QiaCube (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: Brain samples were lysed in Qiazol Lysis Reagent and total RNA was extracted using the MaXtract High Density kit with further purification using the RNeasy Mini Kit (all Qiagen). 70 ng of total RNA per sample was then hybridized with reporter and capture probes for nCounter Gene Expression code sets (Mouse Neuroinflammation codeset ...
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from ∼100 mg of root tissue and DNase treated using the RNeasy plant mini kit and RNase free DNase kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... sections of small intestine from the lorikeets were deparaffinized and the DNA extracted using a commercial kit (QIAamp DNA FFPE tissue kit; Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... Genomic DNA was extracted 72 hrs post-transfection using a DNA extraction kit (QIAamp DNA Mini kit; Qiagen, Hilden, Germany). This was subjected to a T7E1 assay following the manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: Total DNA was extracted from frozen fecal pellets using the PowerSoil-htp 96 well DNA isolation Kit (MoBio) or the DNeasy PowerSoil HTP 96 Kit (Qiagen). Barcoded primes were used to amplify the V3-V4 region of the 16S rRNA gene from extracted bacterial DNA using primers 515fB and 806rB via PCR (EMP) ...
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA was extracted from the same tumor region as the single-cell analyses using the Qiagen AllPrep kit and matched normal blood using DNeasy kit (Qiagen). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed with RLT buffer and total RNA was isolated using an RNA purification kit (RNeasy Mini Kit, Qiagen). cDNAs were transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted using either the Nanobind Tissue Big DNA kit (Circulomics, USA) or DNeasy Blood & Tissue Kit (Qiagen, Germany) by following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were homogenized using a motorized pestle and total RNA was extracted and purified using a RNeasy Plant Mini Kit and RNeasy MinElute Cleanup Kit (Qiagen). RNA was sent to GENEWIZ ...
-
bioRxiv - Microbiology 2022Quote: ... Cytochrome b products were excised and purified from the gel using a commercial kit (QIAquick Gel Extraction Kit, Qiagen, Germany), followed by purification of eluted DNA using AMPure XP Magnetic Beads (1X ...
-
bioRxiv - Genetics 2022Quote: ... These cells were lysed with Precellys CKMix Tissue Homogenizing Kit (Bertin Technologies) and total RNA was extracted using Qiagen RNeasy Maxi Kit (Qiagen). mRNA was isolated with Oligo (dT)25 Dynabeads (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... according to manufacturer’s protocol (MiScript Primer assays and II RT kit for cDNA synthesis and MiScript SYBR Green PCR Kit for RT-qPCR, 218161, Qiagen) from which the recovery of cel-miR-39 spike-in control was confirmed.
-
bioRxiv - Neuroscience 2020Quote: mRNA isolation and reverse transcription reaction were performed respectively with RNeasy Mini kit and with QuantiTect Reverse Transcription kit (both from Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from Ca9-22 cells after 4 or 5 hours of culture using the RNeasy Mini prep Kit and cDNA was prepared using the RT2 First Strand Kit (Qiagen) or the qScript™ cDNA Synthesis Kit (Quanta Biosciences ...
-
bioRxiv - Developmental Biology 2021Quote: gDNA extraction for genotyping was performed on snap-frozen culture-derived cells using the DNeasy Blood & Tissue Kit and the QIAmp DNA Micro Kit from Qiagen, according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA extraction was performed using the QIAamp 96 DNA kit and the Qiacube HT kit and the Qiacube HT (both from Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... All DNA purifications were performed using a Roche High Pure PCR product purification kit or a QIAquick Gel Extraction Kit (Qiagen). Standard procedures for DNA digestion and ligation were used in conditions recommended by the enzyme manufacturer (Promega or Fermentas) ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid and genomic DNA isolations were carried out with the QIAprep Spin Miniprep Kit and the DNeasy Blood & Tissue Kit (Qiagen), respectively.