Labshake search
Citations for Qiagen :
2551 - 2600 of 3042 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: Blastocysts were washed with DPBS containing 1 mg/ml polyvinylpyrrolidone (PBS-PVP) and transferred into 50 μl droplets of 0.1% protease (Qiagen) to remove the zona pellucida ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted by incubation with 6 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, 1% SDS, 0.1 mg/ml proteinase K (Qiagen, 19131)) at 55°C for 16 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... V2 and V3 amplicons were resolved in the 1% agarose gel and purified using the gel purification kit (Qiagen). Each cDNA was cloned into pDONR201 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA (gDNA) was extracted from J-Lat cells 10.6 and HIV-1 negative CD4+ T cells with the QIAcube (Qiagen), using the QiaAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Rainbow proviral HIV-1 DNA dPCR assay was performed on a QIAcuity Four digital PCR platform (Qiagen, Germany) with at least 500 ng (CD4+ T cell ...
-
bioRxiv - Immunology 2023Quote: ... and approximately 1 µg of isolated RNA was converted to cDNA using RT2 First Strand Kit (Qiagen, Hilden, Germany). cDNA was diluted (1:10 ...
-
bioRxiv - Systems Biology 2023Quote: ... Large fragments (200-400 bp) were extracted from a 1% agarose gel with QIAquick Gel Extraction Kit (Qiagen, Netherlands). The final library was sequenced as 85 bp long single-end reads on a NextSeq™ 550 (Illumina ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 µg of each sample was used to prepare 20 µL cDNA using RNeasy Plus Mini Kit (Qiagen). Human RT2 Profiler™ PCR Array ...
-
bioRxiv - Physiology 2022Quote: ... Lysates were centrifuged at 100,000 x g for 1 h and the supernatant were affinity purified on Ni-NTA resin (Qiagen) by batch binding for 30 min-1h ...
-
bioRxiv - Microbiology 2022Quote: ... and then homogenized tissues in 1 ml PBS containing a penicillin/streptomycin mixture by using a TissueLyser II (Qiagen) at 30-Hz oscillation frequency for 3 min ...
-
bioRxiv - Microbiology 2022Quote: Airway epithelium cultured on 6.5-mm Transwell membranes was washed and treated for 1 min at RT with RLT buffer (Qiagen) with 0.01 % β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The lysate was centrifuged at 50,000×g for 10 min and to the supernatant 1 mL of 50% Ni−NTA (Qiagen) was added and incubated for 1 h at 4 °C ...
-
bioRxiv - Genomics 2024Quote: ... Homogenization buffer for RNA purification was made by adding 1:100 beta-mercaptoethanol to Buffer RLT (Qiagen, Valencia, CA) and kept on ice until use ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then washed with 1× PBS and treated with 100 μg/mL of RNase A (Qiagen, USA) followed by staining with 50 μg/mL of propidium iodide (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Material was ruptured two times for 1 min at 30 Hz in a TissueLyser (Qiagen Inc., Germantown, MD, USA). Between and after these two steps of tissue disruption ...
-
bioRxiv - Genomics 2023Quote: ... After overnight proteinase K digestion in Lysis Buffer (BNG) and 1-hour treatment with RNAse A (Qiagen, MD,USA), plugs were washed 4 times in 1×Wash Buffer (BNG ...
-
bioRxiv - Cancer Biology 2024Quote: ... doxycycline was added at (0.1 μg/ml, 1 μg/ml (CHRDL2 +) or 10 μg/ml (CHRDL2 ++) RNA was extracted (RNeasy, QIAGEN) and quantified by real-time reverse transcriptase polymerase chain reaction (qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Genomics 2023Quote: ... 1×106 cells were harvested from each culture and DNA was extracted using QIAamp DNA mini Kit (QIAGEN 51304). STR analysis was performed with PowerPlex 21 System (Promega DC8902 ...
-
bioRxiv - Immunology 2023Quote: The post-caval lobe of the lung was weighed and homogenized in 1 mL of PBS (pH 7.4) using a TissueLyser LT (Qiagen). RNA was extracted using TRIzol™ LS Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Undifferentiated myoblasts (day 0) and differentiated myotubes (day 7) were collected and lysed in 1 mL of Qiazol (Qiagen). RNA from undifferentiated and differentiated myoblasts was extracted using the Qiagen miRNeasy kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was lysed with a lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 20 mM EDTA, 1% SDS) and proteinase K (Qiagen) was added to samples to degrade proteins ...
-
bioRxiv - Immunology 2022Quote: ... The complementary DNA (cDNA) was synthesized from 1 μg of total RNA using QuantiTect Reverse Transcription Kit (Qiagen: 205311) and quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of extracted RNA from each sample was used for the cDNA synthesis (cDNA synthesis kit, Qiagen, Germany) according to the suppliers’ protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-seq libraries were prepared from 1 μg total RNA using the QIAseq FastSelect -rRNA Yeast kit (Qiagen 334217) and QIAseq Stranded RNA Library kit (Qiagen 180743 ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Physiology 2024Quote: ... RNA (1 μg, quantified via Nanodrop-2000 spectrophotometer) was transcribed to cDNA using the QuantiTect Reverse Transcription kit (QIAGEN) and stored at -20°C prior to analysis ...
-
bioRxiv - Plant Biology 2024Quote: ... four leaf discs (1 cm in diameter) were snap frozen in liquid nitrogen and powdered using a TissueLyser (QIAGEN). Total proteins were extracted from the powder using 400 μL GTEN buffer (10% glycerol ...
-
bioRxiv - Plant Biology 2024Quote: ... and ground for 1 min at 30 Hz with the pre-cooled Retsch Mill (Tissue Lyser II, Retsch, Qiagen). For quantification of S ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 µg of total RNA using the RT2 First Strand Kit (Qiagen, Germantown, MD, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... and were then incubated with or without triton-x (1% v/v) and with or without Rnase-A (Qiagen #19101 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 MES or CP cells were harvested and RNA extraction was performed using Rneasy mini plus kit (Qiagen). 1 μg of total RNA was used for the construction of sequencing libraries and sequencing.
-
bioRxiv - Microbiology 2024Quote: ... for 10 min and the cell lysates were incubated with 1 mL of prewashed Ni-NTA Agarose beads (QIAGEN) shaking at 4°C for 1.5 h ...
-
bioRxiv - Microbiology 2024Quote: The typhoid toxin was purified from BL21 DE3 pETDuet-1 encoding pltBHis pltAMyc and cdtBFLAG using NiNTA agarose (Qiagen) affinity chromatography according to manufacturer instructions as previously described (Ibler et al 2019) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA on the exterior of filtered capsids was digested for 1 h at 25°C with 20.3 units DNase (79254; Qiagen) supplemented with 10 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was used to synthesize cDNA using a QuantiNova Reverse Transcription kit (205410, Qiagen, UK). qPCR was performed using QuantiNova SYBR green (208052 ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated with Dynabeads for 2hr at 4°C and washed as previously described [89] prior to being eluted in elution buffer (1% SDS, 1mM EDTA, 0.01M pH 8 Tris-HCl, and 0.2M NaCl) supplemented with proteinase K (Qiagen, 1114885) and Rnase A (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Genomics 2024Quote: Total RNA was isolated from 1 million microglial cells per cell line using the RNeasy Mini kit (QIAGEN, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... using random hexamers and diluted 1:10 prior to quantification by qPCR (QuantiFast SYBR Green PCR kit, Qiagen, #28025013) using a Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... samples were subjected to bead-beating by adding 100 mg of 0.1 mm zirconia beads and 1 ml of inhibiTEX buffer (Qiagen) to each tube ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were incubated with 20 μg/ml propidium iodide (containing 0,5% Tween-20, 1% BSA and 10 μg/ml RNase A (Qiagen) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 µg of viral RNA were utilized to transfect HeLa cells cultured at 37°C using TransMessenger reagent (Qiagen) following the manufacturers protocol ...