Labshake search
Citations for Qiagen :
201 - 250 of 1518 citations for S 3 Amino 4 4 cyanophenyl butanoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 30 cycles) and the 170bp band purified on a 4% agarose gel (Qiagen gel purification). Fragments were extended with homology arms (Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Plant Biology 2022Quote: Total plants RNA were extracted from 4 weeks plants using the RNeasy kit (Qiagen, Germany) and two micrograms of RNA was reverse-transcribed using SuperScript IVTM Reverse Transcriptase according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatant was added to a gravity column containing 4 mL of Ni-NTA (Qiagen). Beads were washed with a high salt buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... to which 4 μL of RNase A (100 mg/mL) was added (Qiagen, Germantown MD). The cell lysate was applied to a DNeasy Mini spin column ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μl of siRNAs were mixed with 37.5 μl of Hiperfect transfection reagent (301707, Qiagen) and enough Optimem Opti-MEM reduced serum medium (31985070 ...
-
bioRxiv - Immunology 2024Quote: ... organ parts collected as described above were homogenized by TissueLyser II (Qiagen, 25Hz, 4 min) and centrifuged to remove debris ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned with the UltraClean 96 PCR Cleanup kit (Qiagen, Cat. #12596-4) and pooled using the same volume for each sample ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluent was then incubated overnight at 4°C with Ni-NTA beads (Qiagen, 36111), which were subsequently collected ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or from whole fecal pellets using a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4). Library preparation and sequencing was performed at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Cell Biology 2024Quote: ... Larval DNA was extracted with the MagAttract PowerSoil DNA EP Kit (Qiagen, 27100-4-EP). Following the Earth Microbiome Project protocol (http://www.earthmicrobiome.org/) ...
-
bioRxiv - Plant Biology 2024Quote: ... 4-5 leaf pieces from clip-inoculated samples) using RNeasy Plant Mini Kit (Qiagen, Germany). Depending on the RNA concentration ...
-
bioRxiv - Microbiology 2024Quote: ... and Fcwf-4 cells using an RNeasy Mini Kit (QIAGEN, Chuo-ku, Japan, Cat# 74104) and QIAshredder (QIAGEN ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from leaf 4 using the RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... steps were carried out at 4°C centrifuge as described previously using RNeasy kit (Qiagen) [84] ...
-
bioRxiv - Developmental Biology 2024Quote: ... 15 mM DTT) and then treated with 2 μL of 4 mg/mL Protease (QIAGEN) by incubation at 55°C for 6 hours ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA extractions were performed with the MagAttract PowerSoil DNA kit (Qiagen, Cat. No. 27000-4-KF) optimized for the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) or the E.Z.N.A Total RNA kit I (Omega-Biotek) ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 4-day-old Arabidopsis seedlings using RNeasy Plant Mini Kit (Qiagen). For cDNA synthesis ...