Labshake search
Citations for Qiagen :
201 - 250 of 435 citations for IL 8 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from Arabidopsis seedlings (8 seedlings per sample) using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) 24 h after the elicitor treatment ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Microbiology 2023Quote: ... an unbiased amplification method was employed by amplifying the purified DNA at 30°C for 8 hours using a REPLI-g Single Cell kit (Qiagen). The amplified DNA was purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: ... After ligation nuclei were pelleted and resuspended in cold PBS with DAPI to a final concentration of 300nM and GFP+ cells were FAC-sorted into a 96 well plate with 2ul lysis buffer (20mM Tris pH 8, 20mM NaCl, 0.15% Triton X-100, 25mM DTT, 1mM EDTA, 500nM Carrier ssDNA, and 15ug/mL Qiagen Protease) and lysed for 1 hour at 50°C and inactivated 15 minutes at 70°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated from flash frozen 8 μm thick sections of tibialis anterior muscles embedded in OCT using the RNeasy Mini Kit (Qiagen) and evaluated using the RNA high sensitivity kit (Agilent RNA 6000 Pico Kit ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 75 ng of rRNA was reverse transcribed and amplified with 8 PCR cycles using the OneStep RT-PCR kit (Qiagen) and primers MS2_quant_F and MS2_quant_R (Supplemental Table 5) ...
-
bioRxiv - Microbiology 2024Quote: ... samples were resuspended in 100 μl TE buffer pH 8 and RNA extraction performed according to the RNeasy Mini Kit (Qiagen) protocol with few modifications ...
-
bioRxiv - Biochemistry 2023Quote: ... SUMO protease was added at a final concentration 1/10 and the mixture was dialyzed overnight at 4 °C against the buffer DB6 (50 mM Tris-HCl pH 8, 150 mM NaCl, 10 mM imidazole) and applied on a NiNTA column (Qiagen) equilibrated in the DB6 buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: DNA was isolated from each of the 8 samples of flies using an adaptation of the Gentra Puregene Cell Kit protocol (Qiagen, 158767). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Neuroscience 2020Quote: DNA and RNA from 8-10 mice was isolated and purified with AllPrep-DNA/RNA/miRNA-universal kit (Qiagen, Montreal, QC) and concentrations were determined by fluorometry on the Qubit system (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 8) and the supernatant was incubated with 80 μl pre-washed Ni-NTA coated Sepharose beads (Ni-NTA agarose, (Qiagen, Hilden) for 90 mins at 4°C on a rolling incubator ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... pods from 8-10 different plants were pooled and RNA was isolated using RNAeasy plant mini kit (Qiagen, Germantown, MD, USA). RNA libraries were prepared using standard Illumina protocols and RNA sequencing was performed using NovaSeq 6000 PE150 by Novogene co ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA was extracted in pools of 6-8 adult mosquitoes mosquitoes using Blood & Cell Culture DNA Midi Kit (Qiagen, Cat# 13343) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
bioRxiv - Bioengineering 2019Quote: ... Up to ∼2 million cells were resuspended in 100 μl High-TE buffer (10 mM Tris-Cl, pH 8, 10 mM EDTA, 25-100 μg/ml RNase A (QIAGEN, Cat. # 19101)) and lysed by adding 2.5 μl 20% SDS ...
-
bioRxiv - Genetics 2022Quote: ... The PCR amplification was carried out in a 10-μl reaction volume containing 8 μl of Taq PCR Master Mix (Qiagen, Hilden, Germany), 10 μM of each primer (1 μl) ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was isolated from 10-20 8-μm frozen tissue sections of biopsies from humanized mice using the PureGene DNA isolation kit (Qiagen, Hilden, Germany). PCR was performed with six framework region 1 subgroup specific primers and a JH primer mix (3’ JH mix ...
-
bioRxiv - Developmental Biology 2021Quote: ... from entire blastocysts (sibling day-8) was whole-genome amplified by multiple displacement amplification (MDA) with a REPLI-g Single Cell Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions with full or half reaction volumes for the fast 3-h protocol ...