Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Endothelin 1 ET 1 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 1 hour at room temperature followed by isolation with a minElute RNA Cleanup Kit (Qiagen). 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µg of RNA was reverse-transcribed to cDNA using the Quantitect Reverse Transcription Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was harvested from cell pellets of 1 million cells using the RNeasy Mini kit (Qiagen). DNA was digested using the TURBO DNA-free Kit (Ambion ...
-
bioRxiv - Genetics 2020Quote: ... Conditions for a 25 μl PCR reaction using the 1 × Taq PCR Master Mix kit (Qiagen) were ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 μg of RNA was reverse-transcribed into cDNA using the RT Omniscript cDNA kit (Qiagen), and 20 ng of cDNA template was amplified on a LightCycler-480 (Roche ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 RNA was extracted from plasma samples using QIAamp Viral RNA Mini Kit (Qiagen, #52904). Followed by first-strand cDNA synthesis using Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 μg of total RNA was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR 2 products were purified by 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), eluting with 15 μL of Elution Buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted using the RNeasy Plant Mini Kit with in-column Dnase 1 digestion (Qiagen). 200 ng of total RNA were reverse transcribed using 500 ng of oligo(dT)15 and the ImProm-II Reverse Transcription System following the manufacturer’s instructions (Promega) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA synthesis was performed from 1 μg of total RNA using the Omniscript RT Kit (Qiagen). All the samples were analyzed in triplicate using GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... and cell-associated HSV-1 DNA was isolated with the QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: cDNA from 1 µg of RNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: 1 µg of the total RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized from 1 μg of total RNA using QuantiTect® reverse transcription kit (Qiagen) in 20 μl reaction volume ...
-
bioRxiv - Cell Biology 2022Quote: ... run on a 1 % agarose gel and gel extracted using QIAquick Gel Extraction Kit (#28704, Qiagen). tdTomato and neomycin were cloned out from H3.1-miCOUNT (Denoth-Lippuner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... run on a 1 % agarose gel and gel extracted using QIAquick Gel Extraction Kit (#28704, Qiagen). The plasmid backbone ...
-
bioRxiv - Immunology 2021Quote: DNA from 1-2 stool pellets was extracted using the QIAamp DNA Stool Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... was extracted from adipose tissue (experiment 1) using the Dneasy Blood and Tissue Kit (Qiagen, # 69504). We amplified both the mouse genomic gene Glyceraldehyde 3-phosphate dehydrogenase (Gapdh ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were purified on a 1% gel and extracted using QIAquick Gel Extraction Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1 mg of RNA was reverse transcribed to cDNA using the Omniscript RT Kit (Qiagen). qPCR was performed using the TaqMan assay system ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ug of RNA was reverse transcribed to cDNA with the QuantiTect reverse transcription kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... size-selected on a 1% agarose gel and purified using the MinElute PCR Purification Kit (Qiagen). The DNA library was then cloned into the vector using four In-Fusion cloning reactions according to the manufacturer’s instructions (Clontech In-Fusion HD) ...
-
bioRxiv - Genomics 2021Quote: ... size-selected on a 1% agarose gel and extracted with the QIAquick Gel Extraction Kit (Qiagen). The eluates were pooled and purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Genomic DNA from 1 g leaf material was isolated using the DNeasy Plant Maxi kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... RNA was extracted from THP-1 and cDNA was synthesized using RT2 First strand kit (Qiagen). Pre-designed RT2 qPCR primer assays (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 ml of PE buffer and 100 μl of EB buffer (MinElute PCR Purification Kit, QIAGEN).
-
bioRxiv - Microbiology 2020Quote: ... 1 mL for OD600 ~0.4 for 10% CO2) and stabilized by RNA Protect Bacteria Kit (Qiagen). Next ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA from A549 cells (1 × 106 cells) was extracted using miRNeasy Mini kit (Qiagen, Denmark) according to the manufacturer’s instructions and eluted in 60 µl of nuclease free water ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-month-old zebrafish (1 fish/sample) using the RNeasy Mini Kit (Cat. No. 74104; Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... at 50 °C for 1 hour and were purified with a MinElute PCR Purification Kit (QIAGEN).
-
bioRxiv - Microbiology 2022Quote: ... HSV-1 DNA within cells was isolated from frozen pellets using QIAamp DNAMini Kit (Qiagen: 51304).
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of RNA was used for cDNA synthesis with the QuantiTect Reverse Transcription kit (Qiagen). Samples were diluted 2.5x after cDNA synthesis and SYBR™ Select Master Mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted from approximately 1 million cells per condition using DNA extraction kit (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2022Quote: ... and 200 µM VLCFA mix for 1 d using the RNeasy Plant kit (QIAGEN, Hilden, Germany). For isolation of RNA from the bending site of roots ...
-
bioRxiv - Systems Biology 2023Quote: Small cfRNAs were extracted from ~1 mL of plasma using the miRNeasy Serum/Plasma Kit (Qiagen). 1ul ExiSEQ NGS Spike-in (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAs were converted to cDNA using 1 μg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse Transcription was performed on 1 µg of RNA using a QuantiTect Reverse Transcription Kit (Qiagen), and qPCR was performed using a QuantiNova SYBR Green PCR kit (Qiagen) ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 1 mL buffer RLT from the RNeasy mini kit (Qiagen, Germany) with a 1:200 dilution of β-mercaptoethanol (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 µg of RNA was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). Transcript quantification was performed in 96-well plates ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 µg of RNA was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). Transcript quantification was performed in 96-well plates ...
-
bioRxiv - Genomics 2023Quote: ... for 1 hour at room temperature followed by isolation with a minElute RNA Cleanup Kit (Qiagen). RNA concentrations were measured by Nanodrop and total RNA integrity assayed using an Agilent Bioanalyzer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µg of total mRNA from each sample was retrotranscribed using QuantiTech reverse Transcription Kit (Qiagen). Real-Time PCR was performed using SYBR Green Master Mix (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 1 ml of overnight culture (DNeasy Blood and Tissue Kit—Qiagen) pre-treated with 100 μg of lysostaphin (Sigma cat ...
-
bioRxiv - Genomics 2023Quote: ... cfDNA was isolated from 1 mL of plasma using the QIAGEN Circulating Nucleic Acids Kit (QIAGEN), eluted in AE buffer ...