Labshake search
Citations for Qiagen :
201 - 250 of 2073 citations for Acyl protein thioesterase 2 LYPLA2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Microbiology 2021Quote: ... His-tagged uSpike was purified using Ni-NTA agarose (Qiagen, Germantown, MD) in a gravity flow column ...
-
bioRxiv - Microbiology 2019Quote: ... His-cyAbrB1 was purified with the Ni-NTA Fast Start kit (Qiagen). The elution fractions containing the purified protein were loaded onto a PD MidiTrap G-25 column (GE healthcare ...
-
bioRxiv - Plant Biology 2019Quote: ... His-NaERF2-like were expressed and purified with Ni-NTA agarose (QIAGEN). Biotin labeled probe EM13 (5’-tagattATCTaattctact-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... His-tagged TEV protease was removed by incubation with Ni-NTA (Qiagen) overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... The His-tagged HTa was purified with Ni-NTA agarose beads (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: His-tagged MCP/scFv-GFP was purified with Ni-NTA-agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... His-tagged VndA was purified over a Nickel-NTA agarose resin (Qiagen) according to manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged σNS was loaded onto a Ni-NTA agarose column (Qiagen) and eluted using a gradient of 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Biochemistry 2023Quote: ... a conjugate of mouse monoclonal penta-His antibody and horseradish peroxidase (Qiagen) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... the solubilized His-tagged histones were purified using Ni-NTA beads (Qiagen). For untagged H2B ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein purification was performed using Ni+2-NTA agarose affinity chromatography according to standard protocol (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... Protein extract was subjected to IMAC by incubation with 2 ml Ni-NTA resin (Qiagen, Germany) per 50 ml of extract ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biophysics 2021Quote: The His-tagged TCF7L2 constructs were affinity purified using Ni-NTA agarose (Qiagen) and the tagged cleaved from the protein using thrombin ...
-
bioRxiv - Microbiology 2020Quote: ... Western blot analysis was performed using the Penta His HRP conjugate kit (Qiagen). To check for equal loading ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... The His-tagged TEV protease was removed by incubation with Ni-NTA (Qiagen) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... a penta-His HRP conjugate was used (1:4000, QIAGEN GmbH, Hilden, Germany). The detection of GFP was performed with the primary antibody anti-GFP (1:10000 ...
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: Assay mixes consisted of 25 nM ALEXA488-conjugated penta-His antibody (Qiagen # 35310), 50 μM DTT ...
-
bioRxiv - Microbiology 2022Quote: ... His-Hcp was purified from the soluble fraction by NTA-resin chromatography (Qiagen). Purified protein was desalted with a PD-10 desalting column (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... The His-tagged nanobodies were purified by using Ni-NTA purification column (Qiagen) followed by desalting step using disposable PD-10 desalting columns (Cytiva ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged SLFN11 (residues 349-901) was purified by Ni-NTA beads (Qiagen). All purified GST- or His-tagged proteins were dialyzed against a buffer containing 50 mM Tris-HCl and 150 nM NaCl and validated by Coomassie blue-stained SDSLJPAGE.
-
bioRxiv - Cancer Biology 2024Quote: rEDA was produced intracellularly using the pQE-30 His tag purification system (Qiagen) in E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 200nM siRNA/well were used for transfection using 5µl/well of Hi-Perfect (Qiagen) following manufacturer’s recommendation.
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were probed with antibodies against His6 (penta-His Qiagen catalog #34460; 1:10,000), FLAG2 (Sigma catalog #A8592 ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant containing target proteins was passed through a polypropylene column containing 2 ml Ni-NTA resin from Qiagen. After the target protein bound to the Ni-NTA resin ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...