Labshake search
Citations for Qiagen :
201 - 250 of 2752 citations for 7 Chloro 5 methyl 1H pyrrolo 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... Cell debris was cleared by centrifugation at 40,000 g for 45 min at 4°C and supernatant was applied to His-tag affinity purification using Ni-NTA agarose (beads or 5 ml column, Qiagen) in buffer A (50 mM TRIS ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA extraction from all fractions was performed using Qiazol at 65°C for 5 minutes with regular mixing and then purified with miRNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... and precipitated with ammonium sulfate as in Niu et al.49.The precipitate was dissolved in 30 ml buffer C and loaded onto a 5 ml column of Ni-NTA-agarose (Qiagen) pre-equilibrated in buffer C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The material stored in Qiazol was heated at 65°C for 5 min and RNA was extracted using the RNeasy Lipid Tissue Kit including the optional DNase digestion (Qiagen). RNA quality and concentration were assessed using a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Genomics 2022Quote: ... We incubated the reaction for 5 minutes at 55 °C in a G-Storm GS1 (G-Storm) thermal cycler and after incubation added 5 μl Buffer PB (19066, QIAGEN) to inactivate and strip the transposase from the tagmented DNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... by centrifugation (200 x g for 5 min at 25°C. Whole RNA was isolated using the Qiagen RNeasy kit (Qiagen) according to the manufacturer’s description ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 5 mM DTT) and incubated for 45 minutes at 65°C before addition of 40 μg Proteinase K (Qiagen) and further incubation for 1.5 hours at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysate was clarified by centrifugation at 5 °C at 18500 rpm for 30 min and loaded to gravity flow Ni-NTA agarose resin (QIAGEN) previously equilibrated with wash buffer WB3_1 (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysates were clarified by centrifugation at 5 °C at 18 500 rpm for 30 min and loaded to gravity flow Ni-NTA agarose resin (QIAGEN) previously equilibrated with wash buffer WB2_1 (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Immunology 2023Quote: ... 40mM Tris-HCl ph 6.5 for 2 hour at 45°C prior to purification with QIAquick PCR Purification Kit (Qiagen). For ‘input’ DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... His6-SUMO-WASHC2C-5-SNAP was purified using lysis buffer #2 and Ni-NTA-agarose beads (Qiagen). The protein was incubated with Ni-NTA beads and washed with 50 mM imidazole ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 and 15 days and purified using RNeasy kit (Qiagen). 1 μg of RNA per condition was used to retrotranscribe into cDNA QuantiTect® Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 3-5 million cells were then harvested and genomic DNA was isolated using QIAamp DNA mini kit (QIAGEN, prod. number 51304). The following L1 recovery steps were adapted from24,52 with modifications ...
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: The methylation status at the Sox8 promoter was scored for using the EpiTect methyl II PCR kit from QiaGen according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA was extracted from fresh leaves of 2 to 3-week-old seedlings for all lines using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... genomic DNA was de-crosslinked in ChIP elution buffer containing 5 M NaCl at 65 °C overnight and purified with the Qiaex II kit (Qiagen, 20021) and eluted in water for PCR amplification ...
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting 1.5 L bacterial culture was incubated at 37°C for 2h and a Maxiprep performed using Qiagen MaxiPlus kit (Qiagen #12963) to a resulting 1 mg of plasmid DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... and 10 zirconium beads were added to approximately 5 mg of intestinal tissue stored at -80 °C in RNA later tissue reagent (Qiagen, Germany). A Tissue lyser (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Biophysics 2022Quote: ... Purified protein was diluted in PBS buffer (pH = 7.2) and the fluorescence intensity was recorded at 60 °C in the Rotor-Gene 6600 real-time PCR cycler (Qiagen) for 18 h ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Microbiology 2019Quote: ... medium at 37°C and was made competent with rubidium chloride according to the method provided in the QIAexpressionist manual protocol 2 (Qiagen). When antibiotic selection was required ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR fragments were incubated with DpnI for 2 h at 37°C to degrade the template plasmids before being purified using a PCR purification kit (Qiagen). The purified PCR fragments were digested overnight at 37°C using NheI and XhoI and ligated overnight at 16°C to backbone vector pYZ125 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Lysates were clarified by centrifugation at 24,000gat 4 °C for 20 min and passed through 2 ml of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... Cell lysate was separated by centrifugation at 28000 x g for 45 min and 4°C and the supernatant was loaded onto a column containing 2 mL of Ni-NTA agarose (Qiagen) equilibrated with buffer A for 1 h for purification by nickel affinity chromatography ...
-
bioRxiv - Microbiology 2019Quote: ... sorted cells were incubated for 2 h at 55 °C and genomic DNA was extracted using Blood and Tissue DNA extraction kit (Qiagen), by omitting the lysis step ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Genomics 2021Quote: ... All plugs were incubated twice (2 hours incubation followed by an overnight incubation) at 50 °C with freshly prepared 167 μl Proteinase K (Qiagen) in 2.5 ml lysis buffer (BioNano Genomics ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Genomics 2022Quote: ... The mixture was incubated at 16°C for 2 h and the resulting double-stranded DNA was purified using the MinElute PCR Purification kit (Qiagen) with 20μl EB for elution ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...