Labshake search
Citations for Qiagen :
201 - 250 of 1331 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 µL Multiplex PCR Master Mix (QIAGEN) and a primer mix (each primer at a final concentration of 0.2 µM) ...
-
bioRxiv - Genetics 2020Quote: ... AC7594-5’-CCGCCTATCCTCGTCATGAAC)andcontrolALG9primers(AC5067-5’-CACGGATAGTGGCTTTGGTGAACAATTAC;AC5068-5’-TATGATTATCTGGCAGCAGGAAA GAACTTGGG) (0.5 µM) and QuantiTect SYBR Green PCR master mix (Qiagen) on a StepOnePlus Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: RNA extraction from sorted CD8 T cell populations pooled from 5-7 mice (week 5 and 8 p.i.) was performed using the RNeasy Plus mini kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg target vector using PolyFect transfection reagent (Qiagen, 301107). Media containing virus was collected both 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Virus Precipitation Solution (System Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3 min at 50 Hz using a TissueLyser LT (Qiagen) with 1 min incubation on ice in between homogenisations ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs targeting the 3’UTR of Arhgap11a were purchased (siRNAflex, Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was incubated with 3 ml Ni-NTA resins (QIAGEN) with gentle agitation at 4 °C for an hour ...
-
bioRxiv - Bioengineering 2023Quote: ... containing 3 μL 4X Probe PCR Master Mix (250102, Qiagen, USA) (final concentration 1X) ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated with binding buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antisense LNA GapmeRs (custom designed, 3’-FAM-labeled, Qiagen, Table S5) were bilaterally microinfused using a 2 μl calibrated micropipette (Hamilton syringes ga 25/70mm/pst3) ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), aliquoted ...
-
bioRxiv - Microbiology 2024Quote: ... and 3) DNA extraction (using here DNeasy Blood & Tissue kit, Qiagen) from the pellet for molecular analysis to detect E ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25 uL T7 Ligase (3×10^6 U/mL) (Qiagen Enzymatics), 15 ng purified amplicon ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCGTCATCAGGATTGGCAA and probe 5’-TGGGTGTCTGCTTTGGAACA were used in a one-step qRT-PCR reaction with either Quantifast reagents (Qiagen) for tissue RNA or LightCycler 480 RNA Master Hydrolysis Probes (Roche ...
-
bioRxiv - Immunology 2024Quote: ... and brain) homogenates collected from mice at 5 dpi and 5 dpc were generated using the Tissue Lyzer II (Qiagen). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... An 80 μL sample of the supernatant was transferred to a new tube and incubated with 5 μL of 5 mg/mL Proteinase K (QIAGEN) for 1 h at 60°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total DNA was extracted from males (N = 5) and females (N = 5) of each genotype using the DNeasy Blood & Tissue kit following manufacturer protocol (Qiagen). Illumina libraries were prepared using the Nextera DNA Flex Library Preparation Kit (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: Isolated dorsal striatal microglia (n = 5-7 per condition) were centrifuged for 5 min at 600xg and resuspended in RLT plus buffer (Qiagen) for extraction and purification of total RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reactions were incubated for 15 min at 60°C and then terminated by adding 1 μL 5 M NaOH to degrade RNA and heating at 95 °C for 5 min followed by neutralization with 1 μL 5 M HCl and one round of MinElute column clean-up (Qiagen). The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA from dorsal mouse skin was isolated from 5 control and 5 transgenic GRK2 eKO animals with RNAEasy Mini kit (#74104, Qiagen), following manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 mm diameter stainless steel beads (QIAGEN) were added to each sample pool ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... and 5-mm stainless-steel beads (Qiagen #69989) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Proteinase K (20 mg/mL, Qiagen) and 100 µl 10% SDS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 5-mm stainless steel beads (Qiagen #69989). RNA purification was performed using the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Physiology 2020Quote: ... with 5 mm beads in RLT buffer (Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5 mm diameter stainless steel beads (Qiagen) and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with 5-mm stainless steel beads (Qiagen #69989). RNA extraction was carried out with the NucleoSpin RNA kit (Macherey-Nagel ...
-
A conserved RNA switch for acetylcholine receptor clustering at neuromuscular junctions in chordatesbioRxiv - Developmental Biology 2024Quote: ... 5 U/μL HotStarTaq Plus DNA polymerase (Qiagen) (0.4 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mm stainless steel beads (Qiagen, Hilden, Germany) and a TissueLyser (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: QIAcuity Probe 5 mL PCR Kit (Qiagen, 250102)
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence (AACTGTAGGCACCATCAAT) was trimmed based on vendor’s recommendation (Qiagen). After adaptor trimming ...
-
bioRxiv - Microbiology 2023Quote: ... then resuspended in 3 mL of RNAprotect for bacterial cells (Qiagen, #76506). Planktonic cultures were similarly pelleted and resuspended in RNAprotect ...