Labshake search
Citations for Qiagen :
201 - 250 of 3715 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Molecular Biology 2021Quote: ... 300 mM of NaCl and 2 μL of RNase A (0.5 mg / mL) (Qiagen) were added to the collective eluates which were incubated at 65 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... the supernatant was applied to 2 mL of pre-washed Ni-NTA resin (Qiagen) at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were then treated with RNase A (2 mg/ml in water, Qiagen, 19101) for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: The supernatant was mixed with 2 mL Ni-NTA resin (Ni-NTA agarose; Qiagen) pre-equilibrated with buffer A200 (50 mM Tris pH 7.6 ...
-
bioRxiv - Cell Biology 2021Quote: ... before adding it to 2 ml of Strep-Tactin superflow resin (Qiagen, Hilden, Germany) which was pre-equilibrated with 10 ml lysis buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... Following a 2-hour RNase A treatment (Qiagen, 100 mg/ml, 1:1,000 dilution) at 37°C ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated for ~2 h rotating at 4°C with Ni-NTA Resin (Qiagen, 1018244) that had been washed with wash buffer (20mM Tris HCl pH 8.0 ...
-
bioRxiv - Genetics 2024Quote: ... 2 or 4 days and genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Bisulfite converted DNA libraries were prepared using the Accel-NGS Methyl-Seq DNA library kit (SWIFT BIOSCIENCES) ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... Genomic DNA was eluted from the column using 5 mL of prewarmed (50°C) QF Buffer (Qiagen, Germany). DNA was precipitated by adding 0.7 volumes of isopropanol ...
-
bioRxiv - Microbiology 2023Quote: TG was quantified in snap-frozen liver tissue stored at −80 □C until cryo-grinding in liquid nitrogen and 50 ±5 mg tissue added 0.9 mL of a 2:1 chloroform:methanol solution and homogenized 1 min at 50 os/sec using a TissueLyser LT (Qiagen) with beads ...
-
bioRxiv - Cell Biology 2020Quote: ... His6-SUMO-WASHC2C-5-SNAP was purified using lysis buffer #2 and Ni-NTA-agarose beads (Qiagen). The protein was incubated with Ni-NTA beads and washed with 50 mM imidazole ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Molecular Biology 2020Quote: ... and gonad were collected and stored separately in 2-mL tubes containing RNA later (QIAGEN) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... cfDNA was extracted from 2 ml of plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and the supernatant was applied to 2 mL of pre-washed Ni-NTA resin (Qiagen) at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... coli* culture from each growth condition were stabilised in RNAProtect Bacteria Reagent (2 mL; Qiagen) and cells pellets were frozen at −80°C prior to processing ...
-
bioRxiv - Bioengineering 2021Quote: ... the obtained soluble extract was mixed with 2 ml slurry Ni-NTA beads (30210, QIAGEN), incubated at 4 °C for 2 h with rotation.
-
bioRxiv - Biochemistry 2021Quote: ... the obtained soluble extract was mixed with 2 ml slurry Ni-NTA beads (30210, QIAGEN), incubated at 4°C for 2 h with rotation ...
-
bioRxiv - Genomics 2022Quote: ... Lysate was spun down and supernatant was mixed with 2 ml Ni-NTA resin (Qiagen) per 50 ml sample and incubated for 1h at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... RNAse A treatment was conducted by adding 2 uL of RNAse A 100ug/mL (Qiagen) and incubating the samples at 37°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... with 200 µl of the resulting supernatant transferred into 2 ml EZ1 sample tubes (Qiagen). 12 µl of Proteinase K was added to the supernatant ...
-
bioRxiv - Genomics 2023Quote: ... Cell-free RNA was isolated from between 2-8 mL following manufacturer’s instructions (Qiagen, 55114). Isolated RNA was DNase-treated (Lucigen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl of diluted cDNA template was mixed with 4 μl QuantiTect SYBR Green PCR Master Mix (Qiagen), 100 nM forward primers (see Table 1 for sequences ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Microbiology 2021Quote: ... Mosquito bodies and legs and wings were put into a 2 ml round-bottom tubes containing 250 ml of PBS and a steel ball (Qiagen). Samples were homogenized using a TissueLyser (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... and early stationary phase (OD = 1.0-1.3).1 mL sample of each culture was directly transferred to 2 mL RNAprotect cell reagent (Qiagen, Hilden, Germany). The samples were vortexed 5 sec ...
-
bioRxiv - Genomics 2021Quote: ... All plugs were incubated twice (2 hours incubation followed by an overnight incubation) at 50 °C with freshly prepared 167 μl Proteinase K (Qiagen) in 2.5 ml lysis buffer (BioNano Genomics ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Biochemistry 2019Quote: ... and the lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4°C for 1 h ...
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...