Labshake search
Citations for Qiagen :
201 - 250 of 1402 citations for 2 6 Amino 9H purin 9 yl ethanol d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was collected from multiple stages of zebrafish development (30%-epiboly, 9 somite, Prim-5, High-pec and Larvae) using the miRNeasy kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Multiple sequence alignment followed by phylogenetic tree construction of precursor miR528 was performed using the alignment tool of CLC genomics (version: 9, Qiagen). The evolutionary tree was constructed using the maximum likelihood method and the Tamura-Nel model (Tamura et al. ...
-
bioRxiv - Plant Biology 2023Quote: Methylation levels in different tissues under control and drought conditions were determined by analyzing the whole genome bisulfite datasets using the bisulfite sequencing plugin of the CLC Genomics Workbench (version: 9, Qiagen) following default parameters ...
-
bioRxiv - Microbiology 2022Quote: ... all infected host cells were washed with PBS and total RNA was harvested using the RNeasy Mini Kit 9 (Qiagen). This RNA was then processed for next generation sequencing as previously described (Sokol et al. ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from hippocampal tissues of 4- and 9-month-old WT and Tau mice using RNeasy Mini kit from Qiagen with DNase digestion ...
-
bioRxiv - Physiology 2024Quote: ... A fraction (10%) of the total lysate volume was mixed with 9 volumes of QIAZOL (Cat. # 79306; QIAGEN, Hilden, Germany) and frozen at -80°C ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from EYFP-positive VCS cardiomyocytes obtained by sorting from 9 weeks old control and VCS-specific Tbx3:Tbx5-deficient mice using RNeasy Mini Kit (Qiagen), followed by DNase treatment according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2023Quote: Sequences comparisons between 16S rRNA and bsh genes/BSH amino acid sequences were performed in CLC Genomics Workbench (Qiagen). 7α-HSDH sequence comparisons were performed using tblastn78 using the translated amino acid sequence from Clostridium absonum44.
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 250 μL of supernatant was recovered and an equal volume of 70% ethanol was then added prior to being placed in RNAeasy columns (Qiagen, Valencia, CA, USA). Columns were washed using multiple buffers and in accordance with the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... phase separation occurred by centrifugation and the top layer was mixed with 400 µL of 75% ethanol prior to running the sample over a RNeasy spin column (Qiagen, RNeasy Mini Kit). 500 ng of RNA was used as a template to synthesize cDNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Physiology 2024Quote: ... Approximately 400 μL of the aqueous phase was mixed with 400 µL of 75% ethanol prior to running the sample over a RNeasy spin column (Qiagen, RNeasy Mini Kit). 500 ng of RNA was used as a template to synthesize cDNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Genetics 2021Quote: ... Electroporated bacteria was split across six tubes and each recovered in 2 mL of SOC for 1 h at 37 °C then added to 500 mL of LB with 100 μg/mL of carbenicillin and grown for 9 h at 37 °C prior to plasmid purification (Qiagen, 12991). The plasmid prep was then normalized to 1 μg/μL to generate the final mpra:minP:gfp library used for transfection delivery.
-
bioRxiv - Genomics 2022Quote: ... equal volumes of the clones were combined together and the pool expanded in 20 mL of LB with 100 μg/mL carbenicillin for 9 hr followed by plasmid purification (Qiagen, 12943). Approximately 250 colonies in total were harvested.
-
bioRxiv - Biochemistry 2021Quote: Purified CrFBA3 was tested for crystallization at two concentration of 9 mg/ml and 4.5 mg/ml on commercial sparse-screening conditions (Qiagen, Hilden Germany) based on the work of Jancarik and Kim (Jancarik ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid DNA was extracted from 3-9 positive colonies where possible after blue-white screening using a QIAprep® Spin Miniprep Kit (Qiagen) and sequenced using the standard T7 primer at Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was isolated from 9 AAA and 10 PAD patients’ serum using the miRNeasy Serum/Plasma Advanced Kit (Qiagen, Hilden, Germany), following in principle the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA samples were initially preserved with 1 mL of activated sludge (i.e., suspended phase) in 9 mL of LifeGuard Soil Preservation (Qiagen, Hilden Germany). This solution was thawed and centrifuged (16,000 g for 1-minute ...
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from 7–9-week-old glial spheres (FMR1+/y and FMR1-/y) using the RNeasy micro kit from Qiagen (74004). RNA was converted to cDNA using RevertAid First Strand cDNA Synthesis Kit (K1621 Thermofisher) ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the relative amino acid content of SLPMh were calculated using the CLC Main Workbench 20.0.1 (QIAGEN, Aarhus, Denmark). Conserved domains in the amino acid sequence of SLPMh were identified based on hidden markov models via the HHPred server (Söding et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... meioc cDNA encoding 356 amino acid residues from N-terminus and ythdc2 cDNA encoding amino acid residue Arg743 to Leu1381 were cloned into a pQE-30 vector (QIAGEN) and a pET-21a (+ ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was then discarded and the tube was air-dried until no traces of ethanol was left prior to dissolving the DNA pellet with 30 µL of Elution Buffer (Qiagen PCR Clean-Up Kit). 1 µL of RNase A (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... We added an equal volume (650 μL) of 70% ethanol to the supernatant and transferred this mixture to Qiagen RNeasy® mini columns (QIAGEN, Germantown, MD, USA). We performed downstream processes following the manufacturer’s instructions with the additional DNase I digestion step ...
-
bioRxiv - Genomics 2020Quote: ... The beads were then washed twice with 70% ethanol and resuspended in 50 μl sample elution buffer (Qiagen AE buffer with 0.1% Tween 20). After incubation at 20°C for 5 min ...
-
bioRxiv - Physiology 2020Quote: ... existing media was removed and the resulting myotubes received either 750 µl of fresh DM alone or 750 µl DM containing 9 µl HiPerFectTransfection™ (Qiagen, UK) and 20 nmol Flexitube GeneSolutions™ (siUBR5 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were co-transfected with the 9 × GCCG-reporter construct and the renilla-luciferase control vector using SuperFect (Qiagen, Valencia, CA) for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was extracted and purified as described in [9] using the Quick-RNA MiniPrep Kit (Zymoresearch, Irvine, CA, USA) and RNeasy MinElute Cleanup Kit (QIAGEN, Hilden, Germany). Per sample at least 150 ng of high-quality RNA were obtained ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25 uL T7 Ligase (3×10^6 U/mL) (Qiagen Enzymatics), 15 ng purified amplicon ...
-
bioRxiv - Cell Biology 2024Quote: ... dynamin 2 (Qiagen), CDC42 (Dharmacon) ...
-
bioRxiv - Cell Biology 2020Quote: Data to derive different biological clocks was available for different subsamples and all based on a fasting blood draw from participants in the morning between 8:30 and 9:30 after which samples were stored in a −80°C freezer or – for RNA - transferred into PAXgene tubes (Qiagen, Valencia, California, USA) and stored at −20°C ...
-
bioRxiv - Genetics 2022Quote: ... and conventional extraction methods (n = 9) using a lysis buffer and purified using silica columns (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). All lysates were analyzed with a QubitTM 4 Fluorometer (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA pellets were washed 3X with 70% ethanol and hydrated in pre-warmed (37°C) Elution buffer (Qiagen, 10 mM Tris-Cl, pH 8.5. Cat. 19086) and incubated on HulaMixer™ Sample Mixer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)