Labshake search
Citations for Qiagen :
2351 - 2400 of 10000+ citations for Mouse T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Bacterial DNA in the mouse fecal samples and GI content (200 mg) was extracted using QIAamp® PowerFecal® Pro DNA kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Whole genome amplification of single sorted cells was carried out by multiple displacement amplification with the REPLI-g single cell kit (Qiagen, Cat. No. 150345), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA preparation and sequencing: Genomic DNA (gDNA) was isolated using the Blood & Cell Culture DNA Mini (<5e6 cells) Kits (Qiagen, cat. no. 13323) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... extracted from A549 cells (RIKEN Cell Bank, Ibaraki, Japan; authenticated) and purified with a high-purity RNA extraction kit (Qiagen Japan, Tokyo, Japan).
-
bioRxiv - Genomics 2021Quote: ... Nuclei pellets and single cells were used to perform WGA using REPLI-g Advanced DNA single cell kit (QIAGEN; Cat No./ID: 150363) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... was isolated using QIAamp DNA Blood Maxi (3x107 - 1x108 cells) or Midi (5x106 - 3x107 cells) kits following protocol directions (Qiagen, #51192 and #51183). gDNA precipitation was then used to concentrate the DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Molecular Biology 2020Quote: ... Single alanine substitutions were introduced throughout the α1M2-M3 linker from L276-T283 in addition to the gain of function α1L9’T pore mutation (rat α1L263T) (QuikChange II, Qiagen). Each construct was verified by forward and reverse sequencing of the entire gene ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and mean TPM value between uninjured tails and tail blastemas were compared with a two-tailed t-test using the CLC genomic workbench with default parameters (Qiagen). A transcript or HHGC was deemed differentially expressed when its fold-change is greater than 2 or less than −2 and the FDR adjusted P-value < 0.05 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Brain and DRG samples from up to four donors per species were homogenized in Tissue Protein Extraction Reagent (T-PER) supplemented with HALT protease inhibitor and benzonase endonuclease using a Tissue Lyser Mixer Mill Grinder (Qiagen), while serum and CSF were directly diluted in supplemented T-PER ...
-
bioRxiv - Cell Biology 2023Quote: ... significantly regulated human proteins (t-test, p-value ≤ 0.01; described above) were characterized by core analysis in IPA® software (version 68752261, QIAGEN Inc. ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from mouse forelimb buds and bamboo shark pectoral fin buds was extracted with the RNeasy Micro and Mini plus kit (QIAGEN, Cat. No. 74034 and 74134). Genomic DNA was removed with gDNA Eliminator columns included with this kit ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from isolated guard cells using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Libraries were prepared at the Crown Institute for Genomics (G-INCPM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA from 108 cell per sample was isolated using the RNAeasy Isolation kit (Qiagen, Germany). Traces of genomic DNA were removed from 10 μg of RNA by digestion in a total volume of 500 μl containing 20 units of TURBO DNase ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was isolated from frozen cell pellets using the Qiagen RNeasy plus Mini Kit (74134, Qiagen) and quantitated using NanoDrop ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from melanoma cell lines using the RNeasy Mini Kit (Qiagen, catalog#:74106) following the protocol manual ...
-
bioRxiv - Cancer Biology 2021Quote: mRNA was extracted from cell lines and tissue samples using the RNeasy plus mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... infected cell supernatant was collected and viral DNA was extracted (DNeasy Blood & Tissue Kit, Qiagen 69504). qPCR was performed on processed viral DNA samples to determine viral copy number.
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were sorted directly into lysis buffer and purified using the RNeasy micro kit from Qiagen. Samples quantity (RNA Integrity Number = RIN ...
-
bioRxiv - Cell Biology 2020Quote: The total RNA of the cells was extracted and purified using RNeasy Plus kit (Qiagen, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Cells were harvested and RNA was extracted using the RNA Easy Mini Kit (Qiagen Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Cell free DNA was extracted from 850μl serum using the QIAamp Circulating Nucleic Acid Kit (Qiagen) and was quantified by TaqMan Real-time PCR (StepOneTM Plus Real-Time PCR System ...
-
bioRxiv - Genetics 2021Quote: DNA from whole-cell populations was purified using the Qiagen DNeasy Blood & Tissue Kit (Qiagen 69504). DNA was isolated from zebrafish as described below ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted from transfected HepG2 cells using RNeasy Plus Mini Kit (Qiagen cat #74136) in accordance with the manufacturer’s recommendation ...
-
bioRxiv - Genetics 2021Quote: ... Cells were harvested 48 h post-transfection and RNA was extracted using RNeasy midi kit (Qiagen). Messenger-RNA was purified from bulk RNA using Dynabeads Oligo(dT)25 beads (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted from transfected HepG2 cells using RNeasy Plus Mini Kit (Qiagen cat #74136) in accordance with the manufacturer’s recommendation (Supplementary table 3 ...
-
bioRxiv - Genomics 2021Quote: ... Lysis buffer (9.5 mL of G2 buffer from the Blood & Cell Culture DNA Midi Kit (QIAGEN) and 19 µL of RNase A (100 mg/mL ...
-
bioRxiv - Genomics 2021Quote: ... MDA was carried according to the SCMDA methodology using the REPLI-g Single Cell Kit (Qiagen) according the published protocol(16) ...
-
bioRxiv - Microbiology 2020Quote: ... at which point cells were harvested and total RNA was extracted using the RNeasy kit (Qiagen). The RNA samples were sent to Genewiz (https://www.genewiz.com ...
-
bioRxiv - Biochemistry 2022Quote: Total DNA from infected cells was extracted and purified using DNeasy Blood and Tissue kit (Qiagen) or Quick-DNA Microprep Kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA (gDNA) was extracted form pelleted cells using DNeasy Blood and Tissue Kit (Qiagen, 69504). 500 ng of gDNA were bisulfite converted using EZ DNA Methylation-Gold Kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2020Quote: ... and genomic DNA (gDNA) was isolated from surviving cells using a QIAmp DNA Mini Kit (QIAGEN) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: Total RNA from cell culture was isolated using Trizol reagent or RNeasy kit (Qiagen, Hilden, Germany) and reverse-transcribed with Quant iNova Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were harvested 48 hours later and RNA was extracted using the RNeasy Mini Kit (Qiagen) with an on-column DNase digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from epidermal cell pellets frozen in TRIzol using the RNeasy Mini Kit (Qiagen) and further processed for mRNA-seq with the Illumina sequencing technology.
-
bioRxiv - Genomics 2020Quote: ... DNA extracts from sorted cells were prepared using with DNeasy Blood and Tissue Kit (Qiagen, 69504) and single-end 100-base sequencing libraries prepared using TruSeq kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from the differentially stimulated B cells using the RNeasy Plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 24 h later cells were harvested and RNA was isolated via the RNeasy Mini Kit (Qiagen). 20 μg isolated RNA was poly-A-selected using Dynabeads Oligo (dT)25 beads (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... after hydroxy tamoxifen treatment cells were collected for genomic DNA extraction (DNeasy blood & tissue kit, Qiagen), 100-200 ng genomic DNA was treated with 16 U of the appropriate restriction enzyme overnight at 37°C ...
-
bioRxiv - Genetics 2020Quote: DNA/RNA extraction was performed from cell lysates using the AllPrep DNA/RNA Micro Kit (Qiagen). For initial optimisation experiments using an HPRT gRNA-containing RNP (or non-targeting control) ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA from cells collected at 24hpi was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany). 100ng RNA was subsequently used as template for reverse transcription using SuperScript IV system (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was isolated using RNeasy minicolumns from cell extracts prepared with QiaShredder (Qiagen RNeasy Kit). The concentration and purity of RNA were assessed by a NanoDrop DM-1000 spectrophotometer (NanoDrop Technologies) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNA of the cultured ATDC5 cells was isolated using the RNAeasy mini kit (Qiagen, 74104). Reverse transcription was performed using 1μg total RNA with the iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Neuroscience 2019Quote: ... Total RNA was extracted from three independent cell cultures using Qiagen RNAeasy plus kits (Qiagen 74134). Human RNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... and plasmid DNA was prepared from the cell pellet using the Plasmid Plus Maxi kit (Qiagen). Coverage for each sub-library was determined by serial dilution and colony counting ...
-
bioRxiv - Genetics 2020Quote: ... Total DNA was isolated from the cell lysates using the QIAquick® PCR Purification Kit (QIAGEN). The following primers used were designed to the lucia DNA sequence for amplification of the reporter gene (JE041 ...
-
bioRxiv - Cancer Biology 2019Quote: ... for cell culture samples or using the QIAamp DNA FFPE Tissue kit and deparaffinisation solution (Qiagen) for formalin-fixed paraffin-embedded (FFPE ...
-
bioRxiv - Cell Biology 2020Quote: For telomere quantification genomic DNA was extracted from cells using the Puregene core Kit A (Qiagen). DNA was quantified using PicoGreen Assay for dsDNA (Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... total RNA was isolated from differentiated 3T3-L1 cells using the RNeasy kit (Qiagen, Hilden, Germany). cDNA was generated using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2019Quote: DNA was extracted from input whole cells and purified nucleoli using DNeasy Blood & Tissue kit (Qiagen). Quantitative PCR analysis was done as outlined previously (Vertii et al ...