Labshake search
Citations for Qiagen :
2351 - 2400 of 2849 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of extracted RNA from each sample was used for the cDNA synthesis (cDNA synthesis kit, Qiagen, Germany) according to the suppliers’ protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-seq libraries were prepared from 1 μg total RNA using the QIAseq FastSelect -rRNA Yeast kit (Qiagen 334217) and QIAseq Stranded RNA Library kit (Qiagen 180743 ...
-
bioRxiv - Genomics 2022Quote: ... Illumina reads for each genome were mapped to the yeast reference genome (R64-2-1, yeastgenome.org) using CLC-Genomics software (Qiagen). Resulting read mapping files were then subjected to copy number and heterozygous single nucleotide polymorphism (hetSNP ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Physiology 2024Quote: ... RNA (1 μg, quantified via Nanodrop-2000 spectrophotometer) was transcribed to cDNA using the QuantiTect Reverse Transcription kit (QIAGEN) and stored at -20°C prior to analysis ...
-
bioRxiv - Plant Biology 2024Quote: ... four leaf discs (1 cm in diameter) were snap frozen in liquid nitrogen and powdered using a TissueLyser (QIAGEN). Total proteins were extracted from the powder using 400 μL GTEN buffer (10% glycerol ...
-
bioRxiv - Plant Biology 2024Quote: ... and ground for 1 min at 30 Hz with the pre-cooled Retsch Mill (Tissue Lyser II, Retsch, Qiagen). For quantification of S ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 µg of total RNA using the RT2 First Strand Kit (Qiagen, Germantown, MD, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... and were then incubated with or without triton-x (1% v/v) and with or without Rnase-A (Qiagen #19101 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 MES or CP cells were harvested and RNA extraction was performed using Rneasy mini plus kit (Qiagen). 1 μg of total RNA was used for the construction of sequencing libraries and sequencing.
-
bioRxiv - Microbiology 2024Quote: ... for 10 min and the cell lysates were incubated with 1 mL of prewashed Ni-NTA Agarose beads (QIAGEN) shaking at 4°C for 1.5 h ...
-
bioRxiv - Microbiology 2024Quote: The typhoid toxin was purified from BL21 DE3 pETDuet-1 encoding pltBHis pltAMyc and cdtBFLAG using NiNTA agarose (Qiagen) affinity chromatography according to manufacturer instructions as previously described (Ibler et al 2019) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 1-2 flies per sample were homogenized in 100 μL phosphate buffer (pH 7.5) using a TissueLyser LT (Qiagen) with 5-mm stainless-steel beads ...
-
bioRxiv - Microbiology 2024Quote: ... DNA on the exterior of filtered capsids was digested for 1 h at 25°C with 20.3 units DNase (79254; Qiagen) supplemented with 10 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was used to synthesize cDNA using a QuantiNova Reverse Transcription kit (205410, Qiagen, UK). qPCR was performed using QuantiNova SYBR green (208052 ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated with Dynabeads for 2hr at 4°C and washed as previously described [89] prior to being eluted in elution buffer (1% SDS, 1mM EDTA, 0.01M pH 8 Tris-HCl, and 0.2M NaCl) supplemented with proteinase K (Qiagen, 1114885) and Rnase A (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Genomics 2024Quote: Total RNA was isolated from 1 million microglial cells per cell line using the RNeasy Mini kit (QIAGEN, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... using random hexamers and diluted 1:10 prior to quantification by qPCR (QuantiFast SYBR Green PCR kit, Qiagen, #28025013) using a Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... samples were subjected to bead-beating by adding 100 mg of 0.1 mm zirconia beads and 1 ml of inhibiTEX buffer (Qiagen) to each tube ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were incubated with 20 μg/ml propidium iodide (containing 0,5% Tween-20, 1% BSA and 10 μg/ml RNase A (Qiagen) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 µg of viral RNA were utilized to transfect HeLa cells cultured at 37°C using TransMessenger reagent (Qiagen) following the manufacturers protocol ...
-
bioRxiv - Genetics 2024Quote: ... Red blood cells were lysed with 0.1% saponin in 1×PBS and parasite DNA extracted with the QIAamp DNA Blood Midi Kit (Qiagen) using a combined RNase and Proteinase K treatment ...
-
bioRxiv - Microbiology 2020Quote: ... We immediately transferred all swabs and film to a microcentrifuge tube with 1 mL lysis buffer and garnet homogenization beads (Qiagen NV ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µM A740003 or both BzATP and A740003 together (A740003 was pre incubated for 1 h before adding BzATP) 24 hours later RNA was extracted using the miRNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was extracted from 1 B6 and two Card19lxcn BMDMs derived from three independent mice using a DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: CIRCLE-seq libraries were prepared for each gRNA (IDT) using genomic DNA extracted from NHGRI-1 (DNA Blood & Tissue kit, Qiagen) following the described protocol [59] ...
-
bioRxiv - Microbiology 2020Quote: ... We sampled 1 ml of the clear phase for living planktonic cells and extracted DNA using DNeasy Blood & Tissue Kit (Qiagen). The cultures were also plated on SHIEH-agar plates with dilutions for cfu/ml -estimation and colony-PCR.
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The tissue was ground to a fine powder by adding 10-15 zirconia beads (1 mm diameter) and using a TissueLyser (Qiagen) for sunflower ligules ...
-
bioRxiv - Genomics 2020Quote: PCR amplicons verified by 1% agarose gel electrophoresis were purified from gel using Gel extraction kit (Qiagen GmbH, Hilden, Germany) and ligated into a pGEM-T easy cloning vector (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from cavin1a/1b DKO and WT zebrafish embryos (> 100 embryos randomly selected from 1 clutch) using the RNeasy Mini Kit (QIAGEN) and cDNA synthesis was performed using SuperscriptIII reverse transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNA was isolated from 1×106 BMMCs that were untreated or treated with IgE receptor crosslinking using the RNeasy mini kit (Qiagen). RNA was treated with DNase I according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmids containing qPCR amplicon sequences were linearized by digestion with SmaI for 1 h and purified using the QIAquick PCR purification kit (Qiagen). Linearized plasmids were quantified using spectrophotometry ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen), for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Genetics 2021Quote: Amplicons spanning the gRNA target sites were amplified from 1 µL of purified gDNA using HotStar PCR Master Mix (Qiagen). Half of each reaction was run on a 1.5% agarose gel ...
-
bioRxiv - Genetics 2020Quote: Bone marrow was isolated by flushing and red cell lysis performed by resuspending pellet in 1 ml of Buffer EL (Qiagen) and incubating on ice for 15 minutes ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were subjected to 1 % agarose gel electrophoresis for analysis and purified with QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: Initial crystals of Nup133NTD-VHH-SAN5 were obtained at 18°C in 1 day as part of the Protein Complex suite (Qiagen) in a 96-well sitting drop tray with a reservoir containing 15% PEG MME 2,000 ...
-
Oligomerization state of the functional bacterial twin arginine translocation (Tat) receptor complexbioRxiv - Biophysics 2021Quote: ... The supernatant was loaded onto a 10 x 1 cm column with 2 mL Ni-NTA Superflow resin (Cat. #30230, Qiagen) that was pre-equilibrated with Buffer A (10 mM CAPS ...
-
bioRxiv - Cell Biology 2021Quote: RNA samples of MS-5 cells cultured alone and in co-culture with SKM-1 cells extracted using Trizol were purified using the Rneasy Plus Micro kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Mecp2 cDNA was amplified for analysis using a forward primer in the 5’ untranslated region and a reverse primer located in the 3’ untranslated region PCR products were fractionated on a 1% agarose gel and purified using the QIAquick gel extraction kit (Qiagen) before being submitted for Sanger sequence analysis ...