Labshake search
Citations for Qiagen :
2301 - 2350 of 3222 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: RNA was extracted from approximately 1×106 cells using the RNeasy Mini kit (Qiagen). DNA was digested using the TURBO DNA-free Kit (Ambion) ...
-
bioRxiv - Microbiology 2020Quote: ... were homogenized 7 min at 50 pulses s-1 with the Tissuelyser LT (QIAGEN) prior to incubation in lysis buffer for 1 h at 60°C for increasing cell lysis ...
-
bioRxiv - Immunology 2021Quote: ... Each tissue was collected into a microcentrifuge tube containing 1 mL of Qiazol (Qiagen) and autoclaved glass beads ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using the QuantiTect RT kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 1 x 75 bp next generation sequencing of placental microRNA was performed by Qiagen Genomic Services (Frederick ...
-
bioRxiv - Biochemistry 2021Quote: ... precleared lysates were mixed with 1 ml Ni-NTA-agarose beads (Qiagen; Hilden, Germany) and incubated for 1 h rotating at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed in PBS and treated with 1:100 volume of RNase-free DNase (QIAGEN) and DMEM media for 30min at 37°C in the incubator ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg mRNA per sample was used to perform reverse transcription (Qiagen, Cat. # 205311). Gene expression levels were then detected using SYBR Green (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 5 mg of frozen liver was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from RPE-1 cells using the RNeasy mini kit (Qiagen, CA) and cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2024Quote: ... 500 µl liquid culture were mixed well with 1 ml RNAprotect Bacteria Reagent (Qiagen) and incubated for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen). SYBR Green I Master (Roche ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 1 mL of culture (DNeasy Blood & Tissue Kit; Qiagen) and quantified on a Nanodrop ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 15 µl of siRNA (1 µM, FlexiTube GeneSolution, Qiagen, Hilden, Germany, see Table S1) were diluted in 1.5 ml culture medium without supplements ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pre-hybridized for 1 hour at 65 degrees in 1X ISH buffer (Qiagen). Digoxigenin-labeled LNA probes against mito-tRNA Asn and nuclear-encoded tRNA Asn designed by Qiagen (sequences in supplementary methods ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 mg tumor tissue was mechanically homogenized in 1 ml Qiazol (Qiagen, Hilden, Germany), whereas cells were lysed in 1 ml Qiazol by resuspending ...
-
bioRxiv - Cell Biology 2022Quote: Reverse transcription was carried out using the miRCURY LNA™1 RT Kit (Qiagen) using 10 ng of RNA according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was isolated from 1 million cells using the RNeasy Mini kit (Qiagen), according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1 kb band was purified using the Qiaquick Gel Extraction Kit (Qiagen) and cloned into pCR2.1 TOPO cloning vector ...
-
bioRxiv - Plant Biology 2023Quote: ... per 1 ml buffer RLC and on-column Dnase digestion with Dnase I (Qiagen). First-strand cDNA was synthesized from 1 μg of total RNA using a Thermo Scientific RevertAid RT Kit (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Total RNA was collected and purified using the RNeasy Mini Kit Part 1 (Qiagen). The total RNA concentration was quantified using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... and the pellet was resuspended in 1 ml of RNA protect bacteria reagent (Qiagen). Then ...
-
bioRxiv - Pathology 2024Quote: ... was used to transfect HMEC-1 with siRNA control or siRNA MC1R oligonucleotides (Qiagen) (20 nM final concentration).
-
bioRxiv - Microbiology 2024Quote: ... The lysates were incubated with 1 ml of prewashed Ni-NTA Agarose beads (QIAGEN) for 1.5 h at 4 °C ...
-
bioRxiv - Genomics 2024Quote: ... The product was purified from a 1% agarose gel (QIAquick Gel Extraction Kit, Qiagen). The oligo pool was then ligated into 200 ng of the linearized plasmid in a 1:10 (vector:insert ...
-
bioRxiv - Immunology 2024Quote: ... HIV-1 RNA was extracted from plasma using the Viral RNA Mini Kit (Qiagen) and quantified by real-time PCR with the TaqMan® Fast Virus 1-Step PCR kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from 1 × 106 cells using RNeasy Plus Mini Kit (Qiagen) with genomic DNA removal ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription of 1 μg RNA was performed using Omniscript RT kit (Qiagen, #205111). CLN3 transcript was amplified ...
-
bioRxiv - Immunology 2024Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (−80°C) ...
-
bioRxiv - Neuroscience 2024Quote: ... we harvested 1 Mio cells or one organoid in RLT buffer (#74104, Qiagen, Germany). cDNA was synthesized with the RevertAid Reverse Transcriptase kit (EP0442 ...
-
bioRxiv - Neuroscience 2024Quote: ... for GST-tagged CMK-1 variants or nickel-nitrilotriacetic acid beads (Ni-NTA, Qiagen) in the presence of 15 mM imidazole for TAX-6-His6 protein binding ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cleavage reactions were stopped by adding 1 μl Proteinase K (20 mg/ml) (Qiagen) and followed by incubation at room temperature for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... The products were purified from a 1% agarose gel (QIAquick Gel Extraction Kit, Qiagen) and ligated by Gibson with 3 h of incubation at 50°C followed by dialysis for 3 h on a membrane filter (MF-Millipore 0.025 μm membrane ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 μL RNA lysis buffer consisting of 1% β-mercaptothanol in RLT Plus (Qiagen) was added to the beads ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein in the soluble lysate was bound to 1 mL Ni-NTA resin (Qiagen), washed with 5 mL low salt wash buffer (20 mM Tris HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... genomic DNA was harvested from 1×106 cells using the Puregene Cell Kit (Qiagen). DNA was diluted to 100 ng/µl in 0.4 M NaOH and 10 mM EDTA (pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...