Labshake search
Citations for Qiagen :
2251 - 2300 of 10000+ citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and EndoFree Plasmid Maxi Kit (#12362, Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... gel purified (MinElute Gel Extraction Kit, QIAGEN) and cloned in frame with the C-terminal VENUS-3xFLAG tag by Gibson assembly ...
-
bioRxiv - Plant Biology 2021Quote: ... and the RNeasy Plant Mini Kit (Qiagen), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... or the QIAprep Spin Miniprep Kit (Qiagen). To replace the Pu promoter of the upper operon of the pWW0 plasmid by the orthogonal transcription T7 system ...
-
bioRxiv - Microbiology 2020Quote: We used the DNeasy PowerSoil Kit (Qiagen) with manufacturers’ protocols to extract microbial genomic DNA from stool samples ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants using RNeasy Mini Kit (Qiagen). Three replicate each of the samples was sent for Illumina NovaSeq 6000 (40 M paired-end reads per sample ...
-
bioRxiv - Molecular Biology 2020Quote: The RNeasy Mini Kit (Qiagen, Valencia, CA) and the SuperScript II cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... using the RNeasy Plus Mini Kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted (RNAeasy kit, Qiagen) and reverse-transcribed (iScript cDNA Synthesis Kit ...
-
bioRxiv - Neuroscience 2021Quote: An RNeasy Mini Kit (Qiagen, Hilden, Germany) was used to isolate total RNA from tissues ...
-
bioRxiv - Neuroscience 2021Quote: ... The RT2 PreAMP cDNA synthesis kit (Qiagen) was used with the Human Aging RT2 PreAMP Pathway Primer Mix ...
-
bioRxiv - Neuroscience 2021Quote: ... and blunt cut (Qiagen quick blunting kit) to generate a blunted AAV vector ...
-
bioRxiv - Neuroscience 2021Quote: ... using the miRNeasy mini kit (Qiagen, Germany). Polyadenylated adaptors were ligated to the 3-end ...
-
bioRxiv - Microbiology 2020Quote: ... and further purification using RNeasy kits (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or MagAttract 96 cador Pathogen Kit (Qiagen) on King Fisher Flex 96 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Mx3000/5P thermocylers series (Agilent)-QuantiFast Probe RT-PCR+ROXvial Kit (Qiagen).
-
bioRxiv - Neuroscience 2021Quote: ... purified with RNeasy® Mini Kit (QIAGEN), quantified the concentration ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was extracted using RNeasy kit (Qiagen) and quantified by spectrophotometer ...
-
bioRxiv - Neuroscience 2021Quote: ... and purified with the RNeasy kit (Qiagen). Quantitative PCR was conducted on an Applied Biosystems 7900HT real-time PCR system (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... The DNeasy Power Soil Pro Kit (QIAGEN) was used for total DNA extraction from fecal and skin swab samples ...
-
bioRxiv - Immunology 2021Quote: RNA was purified using RNeasy Kit (Qiagen) and was analyzed by TapeStation RNA tape (Agilent ...
-
bioRxiv - Biophysics 2020Quote: ... and purified with the RNeasy kit (Qiagen). The obtained cRNAs were either used immediately or aliquoted and stored at 20 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... QIAamp DNA Mini Kit (Qiagen, Cat#51306), or innuPREP DNA/RNA Mini Kit (Analytik Jena ...
-
bioRxiv - Microbiology 2021Quote: ... purified using QIAquick Gel Extraction Kit (QIAGEN), and subjected to Sanger sequencing.
-
bioRxiv - Evolutionary Biology 2022Quote: ... (2019) using a DNeasy tissue kit (Qiagen).
-
Decreasing Wapl dosage partially corrects transcriptome phenotypes in Nipbl-/+ embryonic mouse brainbioRxiv - Genetics 2022Quote: ... and Qiagen RNeasy Micro kit (Qiagen 74004) with on-column DNase I treatment (Qiagen 74004) ...
-
bioRxiv - Microbiology 2022Quote: ... eluted from the gel (Minelute Kit, Qiagen), and sequenced (ABI 3130XL DNA sequencer ...
-
bioRxiv - Genetics 2022Quote: ... we used RNeasy Mini Kit (Qiagen, Germany) to extract total RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated using RNeasy kit (Qiagen), and cDNA was synthesized using an iSCRIPT cDNA synthesis kit (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... using the RNeasy Mini Kit (74104; Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using the DNeasy blood & tissue kit (Qiagen).
-
bioRxiv - Genetics 2022Quote: ... while the QIAseq miRNA Library Kit (QIAGEN) was used to create miRNA libraries ...
-
bioRxiv - Microbiology 2022Quote: ... QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany). The quality and quantity of the extracted DNA were measured using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1X QuantiFast Multiplex PCR kit (Qiagen Inc) and 1 μL of template DNA in Bio-Rad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Microbiology 2022Quote: ... or a QuantiNova Reverse Transcript Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... or the DNeasy Blood & Tissue Kit (Qiagen). A 1048 bp region spanning the gene drive target site was amplified using primers Seq-7280-F (GCACAAATCCGATCGTGACA ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was extracted (Qiagen RNeasy mini kit) and purity was confirmed using an Agilent Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using DNeasy Blood and Tissue kit (QIAGEN) following the manufacturer instructions ...
-
bioRxiv - Genomics 2019Quote: ... or QIAsymphony DSP DNA Mini Kit (Qiagen) as described by the manufacturer ...
-
bioRxiv - Neuroscience 2019Quote: ... The RNeasy Mini Kit (Qiagen, Germantown, MD) was used to extract RNA according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... purified using a PCR Purification Kit (QIAGEN) and sub cloned into pGEM T-Easy vector I (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the QIAquick PCR Purification kit (Qiagen, #28106) was used ...
-
bioRxiv - Genomics 2019Quote: ... destructor using QIAamp DNA Micro Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted (RNAeasy kit, Qiagen) and reverse-transcribed (iScript cDNA Synthesis Kit ...
-
bioRxiv - Microbiology 2019Quote: ... gel purified (MinElute Gel Extraction Kit, Qiagen) and loaded on an Illumina MiniSeq instrument in mid-output mode ...
-
bioRxiv - Systems Biology 2019Quote: ... using a RNeasy Mini Kit (Qiagen S.r.l.), following the manufacturer’s instruction ...
-
bioRxiv - Genetics 2019Quote: ... followed by the RNeasy Mini Kit (Qiagen). The samples were sent to the University of Exeter to perform the library preparation (ScriptSeq RNA-Seq Library Preparation Kit (Illumina) ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Qiagen RNeasy kit (Qiagen 74104). cDNA was made from isolated RNA with the QuantiTect Reverse Transcription Kit (Qiagen 205310) ...
-
bioRxiv - Plant Biology 2019Quote: ... and cleaned with RNeasy Mini kit (Qiagen). Samples were tested for possible DNA contamination by PCR using the RNA samples as templates and primers specific for M ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the RNeasy Micro kit (Qiagen, 74004). 100 ng of RNA was used for RT-PCR with the SuperScript™ IV First-Strand Synthesis System (Invitrogen ...