Labshake search
Citations for Qiagen :
2201 - 2250 of 3263 citations for 2 3 5 Dioxo 4 aza tricyclo 5.2.1.0*2 6* dec 8 en 4 yl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... The digestion products were fractionated on an agarose gel and the 8 kb viral genome band was excised and purified using the QIAquick gel extraction kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from the Ent-Pir Cx collected from the right and left hemispheres of PSD-exposed (n= 8) or 5G-exposed mice (n=7) using RNeasy® Micro kit (QIAGEN). Quality of RNA was confirmed on Agilent TapeStation (RIN > 8) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8–10 larvae per genotype were pooled and total RNA was isolated using the Qiagen RNeasy mini kit (Qiagen catalog # 74104) or Zymo Direct-zol RNA Microprep Kit (Zymo Research catalog # R2060) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final libraries were resuspended in 10 µl of EB buffer (10 mM Tris-Cl, pH 8) from Qiagen (cat. no. 19086) and amplified using 2.5 µl of Universal PCR primer (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 mg of freeze-dried and ground roots were mixed with 1.6 mL of 1 M perchloric acid and homogenized in a TissueLyser II (Qiagen) in microtubes containing 6 glass beads of 2.8 mm in diameter ...
-
bioRxiv - Microbiology 2020Quote: ... Extraction of viral nucleic acids from clinical sample was performed with a QIAamp Viral RNA Mini Kit (Qiagen #52906) as described by manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... Nucleic acid was first extracted from each blood sample using QIAamp MinElute Virus Spin kits (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Headless HA stalk proteins were expressed in 293F cells and purified using nickel-nitrilotriacetic acid agarose (no. 1018244, Qiagen) in 5-ml polypropylene columns (no ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2022Quote: ... followed by total nucleic acid extraction of 400 ul of pretreated stool using the EZ1 Virus Mini Kit v2.0 (Qiagen). Extracts were eluted in 60 ul volume.
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was collected and was mixed with a small volume of preequilibrated Ni-nitrilotriacetic acid (NTA) beads (Qiagen) for 2 h on a rocking platform at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... PrP was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). In the RT-QuIC assay ...
-
bioRxiv - Neuroscience 2020Quote: ... was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified from inclusion bodies by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). Recombinant hamster PrP (HaPrP ...
-
bioRxiv - Biochemistry 2021Quote: ... The ankyrin repeat domains were purified over a Ni-nitrilotriacetic acid column (2.5 ml column volume) according to the manufacturer’s instructions (QIAgen, Germany). Up to 200 mg of highly soluble ankyrin repeat domains were purified from one liter of E ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids from each sample were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA yields were measured using a RT-qPCR assay targeting the rdrp gene as previously described[13].
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized and His6-HA-SUMO1-conjugates were enriched on nickel-nitrilotriacetic acid (NiNTA) agarose beads (Qiagen, #L30210) as described in15 ...
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were moved on magnet and supernatant was transferred to clean 1.5 mL tubes for nucleic acid extraction using the MinElute PCR Purification Kit (Qiagen). Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: We extracted nucleic acids from each 200 μL aliquot using the AllPrep PowerViral DNA/RNA kit (Qiagen, Hilden, Germany) using Glass PowerBead tubes included with the kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted using hot acid-phenol (Uppuluri et al., 2007) and cleaned up using the RNeasy kit (Qiagen). Libraries were prepared using the NuGEN Universal Plus mRNA kit ...
-
bioRxiv - Microbiology 2023Quote: ... Three nucleic acid extraction kits designed for DNA and RNA extraction were compared: DNeasy PowerWater kit (QIAGEN; Hilden, Germany), NucleoSpin Soil ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then lysed and the nucleic acid was extracted using Qiagen Allprep DNA/RNA Mini Kit (Qiagen). Aliquots of DNA were sent to Novogene Co ...
-
bioRxiv - Microbiology 2022Quote: ... protein enrichment and purification was performed as in(Bertani et al., 1999) using a Ni2+ nitriloacetic acid metal-affinity column according to the manufacturer’s instructions (QIAGEN). Proteins were resolved by tricine-SDS-PAGE (Schägger ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm Millex-HV PVDF membrane and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: Sequences comparisons between 16S rRNA and bsh genes/BSH amino acid sequences were performed in CLC Genomics Workbench (Qiagen). 7α-HSDH sequence comparisons were performed using tblastn78 using the translated amino acid sequence from Clostridium absonum44.
-
bioRxiv - Biochemistry 2024Quote: ... 4 µM resazurin) to decrease the initial DDM concentration to 0.5% and incubated with nickel nitrilotriacetic acid (Ni2+-NTA) resin (Qiagen) for 1h at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 mM NaCl) with a French Press and recombinant KPNA2 was purified twice over Ni-nitrilotriacetic acid agarose (Qiagen) under native conditions step wise eluting with buffer P9 (50 mM Tris pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wells contained 5 μl/well TCL-buffer (QIAGEN, cat. 1031576) with 1% 2-Mercaptoethanol ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.12 units of Taq DNA polymerase (Qiagen, 5 units/μL) and 14.44 μL of ultra-pure water ...
-
bioRxiv - Microbiology 2021Quote: ... was added to a column (Qiagen, 5 mL polypropylene column), equilibrated with lysis buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Homogenates were centrifuged at 16,000 g for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and 5 mm stainless steel beads (Qiagen, Cat No. 69989) and briefly centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... 5) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) with modifications ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Insoluble debris was pelleted by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... with two 5-minute cycles on a TissueLyser II (Qiagen) separated by a 5-minute incubation on ice ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mL erythrocyte lysis buffer (EL buffer, Qiagen, Hilden, Germany) was added and PMNs were centrifuged ...
-
bioRxiv - Cancer Biology 2024Quote: ... along with a pre-chilled 5-mm steel bead (QIAGEN). All samples were then placed in pre-chilled cassettes for the Tissue Lyser II and pulverized for at 30 1/s for three 1-minute oscillations ...
-
bioRxiv - Biochemistry 2024Quote: ... a 5 mL Ni2+-NTA HisTrap fast flow column (Qiagen) was equilibrated with 10 mL of buffer containing 20 mM Tris HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... After adding one 5 mm stainless steel bead (Qiagen #69989), the microtube was placed in a TissueLyser II (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µL of QIAGEN Multiplex PCR Master Mix (Qiagen). The thermal profiles used were as follows ...
-
bioRxiv - Genetics 2022Quote: ... The PCR amplification was carried out in a 10-μl reaction volume containing 8 μl of Taq PCR Master Mix (Qiagen, Hilden, Germany), 10 μM of each primer (1 μl) ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was isolated from 10-20 8-μm frozen tissue sections of biopsies from humanized mice using the PureGene DNA isolation kit (Qiagen, Hilden, Germany). PCR was performed with six framework region 1 subgroup specific primers and a JH primer mix (3’ JH mix ...
-
bioRxiv - Developmental Biology 2021Quote: ... from entire blastocysts (sibling day-8) was whole-genome amplified by multiple displacement amplification (MDA) with a REPLI-g Single Cell Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions with full or half reaction volumes for the fast 3-h protocol ...