Labshake search
Citations for Qiagen :
2151 - 2200 of 4884 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Then DNA was purified with a PCR purification kit (QIAGEN). ChIP-seq libraries were prepared by using the NEBNext Ultra II DNA prep kit (NEB E7645 ...
-
bioRxiv - Biochemistry 2024Quote: ... the QIAquick PCR and gel Cleanup kit (28506) from Qiagen was used ...
-
bioRxiv - Biophysics 2024Quote: ... The DNA was purified using PCR spin column (Qiagen, 28104). Insert DNA for pUC19HL_MutS was prepared by annealing two 5’-phosphorylated oligonucleotides 5’AGCTTCCTCAGCTTAATACGACTCACTATAGGCCAATACAAGAGCTTCATCCTCAGCG3’ and 5’AATTCGCTGAGGATGAAGCTCTTGTATTGGCCTATAGTGAGTCGTATTAAGCTGAGGA3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tagmented DNA was purified using MinElute PCR Purification Kit (Qiagen) and eluted in 10 μL elution buffer ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA was extracted using a MinElute PCR kit (Qiagen).
-
bioRxiv - Cell Biology 2024Quote: ... either by gel purification or QIAquick PCR Purification kit (Qiagen) and used as the template DNA for 100μl T3 or T7 polymerase reactions (MEGAscript ...
-
bioRxiv - Cancer Biology 2024Quote: ... ChIP DNA was extracted using QiaQuick PCR Purification kit (Qiagen) and quantified using Qubit Fluorometer 4.0.
-
bioRxiv - Biochemistry 2024Quote: ... followed by purification using a QIAquick PCR purification kit (QIAGEN) and verification via chloroquine-containing agarose gel electrophoresis as described58 ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA was purified using the MinElute PCR purification kit (QIAGEN) and quantified using a Qubit fluorometer.
-
bioRxiv - Genetics 2024Quote: ... We then purified the inserts (Qiaquick PCR Purification Kit, Qiagen).
-
bioRxiv - Genetics 2024Quote: ... and 5 µL of QIAGEN Multiplex PCR Master Mix (Qiagen). The thermal profiles used were as follows ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The product was purified using QIAquick PCR Purification Kit (Qiagen) and eluted in 30 μl and used for qPCR quantification ...
-
bioRxiv - Developmental Biology 2021Quote: ... For gDNA extraction pellets were lysed using 750 μl of Cell Lysis Solution (QIAGEN) containing 100 µg/ml of Proteinase K on a heat-block at 55 °C shaking at 500 RPM for 16 hours overnight ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from the epiphyte C1 solution using the DNeasy PowerSoil kit (Qiagen), and from water microbiome filters using the PowerWater DNA extraction kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... a lysis buffer was prepared by mixing 1M DTT solution (Qiagen, catalog no. 150345) and DLB buffer (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were resuspended in lysis solution [600 μl RLT buffer (RNeasy mini kit; Qiagen); 6 μl 2-mercaptoethanol] and disrupted using sonicator (Ultrasonic processor XL ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in solution were spun down and lyzed using the QIAshredder Kit (Qiagen; 79656). mRNA was harvested using the RNeasy Plus Micro Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... Each embryo was fixed with the PAXgene Tissue FIX solution (Qiagen, PreAnalytics, cat #765312), incubated overnight (17 h +/− 1 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and stored in either 1 ml Cell Lysis Solution (Gentra Puregene Kit, Qiagen, USA), Queen’s buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1x Q solution and 0.017 units of HotStar Taq Plus DNA polymerase (Qiagen, France). PCR was at 95°C for 5 min ...
-
bioRxiv - Genomics 2021Quote: ... treatment in solution followed by purification on a RNeasy Mini Spin Column (Qiagen, 74104), before freezing at -80°C ...
-
bioRxiv - Genomics 2020Quote: ... Next, >300mAU (500μL of >600 mAU/ml, solution) Proteinase K (Qiagen Cat No. 19131) was added to the sample and incubated at 55° C for 3 hours ...
-
bioRxiv - Immunology 2021Quote: ... The clear solution containing lysate was passed through the RNeasy mini column (Qiagen, Germany), which leads to the binding of RNA with the column ...
-
bioRxiv - Developmental Biology 2022Quote: ... This RNA-containing solution was processed using the RNeasy® Mini Kit (QIAGEN, 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the DNA solution was transferred to a DNeasy mini spin column (Qiagen, Hilden, Germany). The solution was then purified following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... We homogenized the flies from each sample in Gentra Puregene Cell Lysis Solution (Qiagen) with ceramic beads using the TissueLyser (Qiagen Inc.) ...
-
bioRxiv - Biochemistry 2024Quote: ... The solution was applied to a column of 5 ml Ni-NTA agarose (Qiagen) equilibrated in Lysis-Wash buffer and the flow-through collected ...
-
bioRxiv - Genomics 2023Quote: ... 85 µl bisulfite solution and 15 µl of protect buffer (Qiagen, cat. no. 59824). The volume of 20 µl of DNA solution (after filling ...
-
bioRxiv - Immunology 2023Quote: ... DNA fragments were purified from enzyme solution using MinElute Enzyme Reaction Cleanup Kit (Qiagen). Libraries were barcoded (Nextera Index Kit ...
-
bioRxiv - Microbiology 2024Quote: ... The rest of the caeca and their contents were placed in RNAprotect solution (Qiagen) for further RNA extraction (Supplementary methods).
-
bioRxiv - Plant Biology 2020Quote: ... The resulting DNA was purified using QIAquick PCR Purification Kit (Qiagen). DNA was quantified with a LightCycler 480 (Roche ...
-
bioRxiv - Synthetic Biology 2021Quote: ... before being purified using a Qiaquick PCR purification kit (Qiagen, #28104).
-
bioRxiv - Neuroscience 2021Quote: ... DNA was purified and eluted using MinElute PCR purification kit (Qiagen). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and DNA was purified with QIAquick PCR purification kit (QIAGEN 28106). ChIP-seq libraries were constructed using the Illumina’s TruSeq ChIP sample preparation kit (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: Precipitated DNA samples were purified by QIAquick PCR purification kit (Qiagen) and quantified by Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and the DNA was purified using the PCR Purification kit (Qiagen). Purified DNA was then subjected to quantitative PCR using three sets of primers targeting the promoter region of atgl-1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNA fragments were then purified with QIAquick PCR kit (Qiagen). A 10% input sample of each condition was used to generate a standard curve and the copy numbers of each immunoprecipitate is presented relative to the standard curve ...
-
bioRxiv - Cell Biology 2020Quote: ... The sonicated DNA was purified with a PCR purification kit (Qiagen) and used to prepare Illumina libraries with the NEB Next Ultra Library Prep kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... transposed DNA was isolated using the MinElute PCR Purification Kit (QIAGEN), followed by x5 PCR cycles using a combination of a PCR primer and an index PCR primer ...
-
bioRxiv - Genetics 2021Quote: ... DNA was purified using a QIAquick PCR Purification Kit (Qiagen, 28104) according to the manufacturer’s guidelines.
-
bioRxiv - Genetics 2021Quote: ... and purified with the Qiagen QIAquick PCR Purification Kit (Qiagen 28104).
-
bioRxiv - Microbiology 2021Quote: ... cDNA Synthesis was performed with OneStep RT-PCR Kit (Qiagen, Germany) and NS specific primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ligations were purified using the MinElute PCR Purification Kit (Qiagen, 28004), and eluted in 10 µL nuclease free water ...
-
bioRxiv - Developmental Biology 2021Quote: ... Digested DNA was purified by column purification (Qiagen PCR purification Kit). Gene fragments for spe-51 (cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were purified using the QIAGEN minElute PCR Purification Kit (Qiagen) and eluted with 11 µL of supplied Elution Buffer ...
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... The samples were purified with the MinElute PCR purification kit (Qiagen) and eluted in 12μL elution buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... Positive HRM samples were isolated using a PCR purification kit (Qiagen) and submitted to the University of Guelph ...
-
bioRxiv - Developmental Biology 2020Quote: ... Appropriate PCR products were cut from gel and purified (QIAGEN, 28706). The purified PCR fragments were digested by SalI/FseI restriction enzymes (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time RT-PCR was performed in the RotorGene system (Qiagen) using SYBR Green (Quanta 95072-012) ...