Labshake search
Citations for Qiagen :
2051 - 2100 of 5664 citations for Primary Human Retinal Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: DNA was extracted from cells using the DNeasy Blood and Tissue Kit (QIAGEN), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... PIGS-B4GALT5-B4GALT6 TKO+B4GALT5-D300A cells using the RNeasy Mini kit (QIAGEN). Each RNA was then transcribed to cDNA using the SuperScript VILO cDNA Synthesis kit (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2020Quote: S2R+ cells were transiently transfected with Effectene transfection reagent (Qiagen, Valencia CA, #301425) and induced 24 hours later with 0.5mM copper sulfate ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from pelleted cells with RNeasy Mini kit (74104; QIAgen) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... cells were incubated in either 10 nM of LNA enhanced detection probes (Qiagen) targeting mRNAs for I-RIM ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was isolated from the cells using the RNeasy kit (Qiagen, Germantown, MD) and cDNA was synthesized by reverse transcription using the First-Strand cDNA Synthesis Kit (Promega ...
-
bioRxiv - Cell Biology 2020Quote: Total RNAs were isolated from HCA1-PalmGRET cells using RNeasy Mini Kit (QIAGEN) and subjected to RT-qPCR to quantify mRNA expressions of ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from cells in Trizol using the RNeasy kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA was extracted from cells using the RNeasy plus mini kit (QIAGEN) following the manufacture protocol ...
-
bioRxiv - Neuroscience 2021Quote: Cell pellets from day 14 LUHMES neurons were resuspended in RLT buffer (Qiagen) with 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were washed in 1 mL of RNAprotect solution (Qiagen, Hilden, Germany), pelleted and stored at −80°C until gDNA extraction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were pooled and genomic DNA was extracted (QIAmp DNA Mini Kit, Qiagen). shRNA sequences were retrieved by a two-step PCR amplification ...
-
bioRxiv - Physiology 2021Quote: RNA from tissues and cells were isolated using the RNeasy Mini kit (Qiagen). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were subsequently lysed by adding 50μl of AL buffer (Qiagen #19075) and incubating for 10 min at 56°C ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was prepared from cell pellets using miRNeasy Micro Kit (Qiagen, 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: Cells were harvested and genomic DNA was extracted with column based kits (QIAGEN). The region of interest ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA was extracted from the cells using an RNeasy Mini Kit (Qiagen) and eluted in 50 μL nuclease-free water ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 2 × 106 cells using QIAzol Lysis Reagent (Qiagen) and cDNA was generated from 0.5 μg of RNA with random hexamers using the GoScript kit (Promega ...
-
bioRxiv - Microbiology 2020Quote: Total RNAs were extracted from 1.2×106 cells using RNeasy mini kit (Qiagen) at 0 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested from the transwell membranes using 350µl RLT buffer (#74104; Qiagen) for downstream RNA extraction ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted from cells using a RNeasy Mini Kit (#74104; Qiagen). Next ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with pNL4-3 vectors using Attractene Transfection Reagent (QIAGEN, Germany). After 8 hr ...
-
bioRxiv - Physiology 2019Quote: Total RNA was extracted from N38 cells using RNAeasy plus kit (Qiagen, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: RNA was extracted from cells via RNeasy Mini Kit (Qiagen, Cat. No. 74104). RNA was eluted in RNAse-free H2O and further purified via treatment with DNA removal kit (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: ... the C2C12 cells were lysed and RNA isolated using RNeasy mini kit (QIAGEN) following manufacturers recommendations ...
-
bioRxiv - Pathology 2021Quote: Saos-2 cells RNA was extracted using RNeasy mini kit (Qiagen, Catalog#:74104). and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... Multiple Displacement Amplification (MDA) using the REPLI-g Single Cell Kit (© QIAGEN). The parental somatic DNA from mass culture and whole genome amplification products from single cells (scDNA ...
-
bioRxiv - Immunology 2021Quote: Total RNA from indicated cell types was isolated using RNeasy Micro kit (Qiagen). Libraries were prepared from 150 ng total RNA input using the QuantSeq 3’ mRNA-Seq Library Prep Kit and UMI Second Strand Synthesis Module (Lexogen) ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells with RNeasy Micro Columns (Qiagen), converted into cDNA (iScript ...
-
bioRxiv - Cell Biology 2019Quote: J774 cells were silenced using a pool of 4 different Flexitube siRNAs (Qiagen) for SYK with Lipofectamine RNAiMAX reagent as described previously 20 ...
-
bioRxiv - Cancer Biology 2019Quote: RNA was extracted from cancer cells by RNeasy Plus Mini Kit (Qiagen #74134). RT-PCR was performed using AccessQuick™ RT-PCR system (Promega #A1700 ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA from cultured cells was isolated using the RNeasy Mini Kit (Qiagen), followed by reverse transcription with 1μg of total RNA/sample (qScript cDNA Synthesis Kit ...
-
bioRxiv - Immunology 2019Quote: Total RNA from 1×106 cells was isolated using RNeasy Mini kit (Qiagen). 50 b.p ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was isolated from cultured cells using the RNeasy mini kit (Qiagen) and treated with RNase-free DNase (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: Total RNA was extracted from sorted cells using an RNeasy Micro kit (Qiagen) and libraries were prepared from 2 ng of total RNA using the NEBNext low input kit (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... and RNA from cell lysates was extracted using a RNeasy Mini Kit (Qiagen) as described previously (20 ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was extracted from cells using the RNeasy Plus Mini Kit (QIAGEN) and submitted to The University of Chicago Genomics core for library preparation and sequencing on a HiSeq4000 platform (Illumina) ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA was extracted from cell pellets using the QIAGEN (QIAGEN, Hilden, Germany) Midi or Mini Kits based on the size of the cell pellet (51183 ...
-
bioRxiv - Genomics 2019Quote: Total RNA from target cells was isolated using a miRNeasy Mini Kit (Qiagen) and hybridized to a custom probe set for expression analysis on the nCounter Digital Analyzer (NanoString Technologies ...
-
bioRxiv - Genomics 2021Quote: ... The DNA was extracted using the Blood & Cell Culture DNA Mini Kit (Qiagen) kit according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: RNA was extracted from 100,000 cells using the miRNeasy Mini Kit (Qiagen, 217004). RNA quantification was done by using the Qubit RNA BR Assay kit (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 × 108 cells were mixed with two volumes of RNAprotect Bacteria Reagent (Qiagen). Samples were lysed in Tris-EDTA (pH 8.0 ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was extracted from pelleted cells using the Rneasy Mini kit (QIAGEN) following manufacturer’s guidelines for animal spin cells ...
-
bioRxiv - Genetics 2020Quote: Total RNA was isolated from cells using a Total RNA isolation kit (Qiagen) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: One million cells were resuspended in 600 μl of RLT Buffer (Qiagen; 79216) containing 1% 2-BME and snap frozen in a dry ice – ethanol bath for RNA isolation ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from cells at 72h post-transfection using Qiazol (Qiagen) following the manufacturer’s instructions and purified using an RNeasy kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from tissue or cells using RNeasy mini-kit (Qiagen), and cDNA was synthesized using iScript cDNA Synthesis kit (BioRad ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from the cells using RNeasy mini Kit (QIAGEN, Germany). The cDNA was synthesized using Χ iScript kit (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... and the living cells were harvested and extracted for genomic DNA (Qiagen kit). Primer-F TTCTCCAATGCGACGGGTGTG and Primer-R AGATAGATGCGGGCTTCCAAC were used to amplify the first exon of RHO ...
-
bioRxiv - Developmental Biology 2021Quote: S2 cells were transfected with Btz-WT or Btz-HD using Effectene (Qiagen) according to the manufacturer’s protocol ...