Labshake search
Citations for Qiagen :
2051 - 2100 of 10000+ citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted from Mv1Lu cells using the RNeasy Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and genomic DNA was extracted using the Gentra Puregene Cell and Tissue Kit (QIAGEN) to obtain WGS data for Panagrolaimidae isolates ...
-
bioRxiv - Cell Biology 2023Quote: Total DNA was isolated from C2C12 cells using DNeasy Blood and Tissue Kit (Qiagen). qPCR was performed with SYBR™ Green qPCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: gDNA samples from cells were prepared with a DNeasy Blood & Tissue Kit (Qiagen, USA). The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was prepared from cells harvested one day post-transfection (RNeasy mini kit, Qiagen) and used for cDNA synthesis (iScript cDNA synthesis kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were collected for total RNAs isolation using RNeasy Plus Mini Kit (Qiagen, 74136). The same amount of total RNAs from each sample were reversely transcribed with PrimeScript RT Master Mix (TaKaRa ...
-
bioRxiv - Molecular Biology 2023Quote: ... the total RNA was extracted from cells using RNeasy Plus Mini Kit (QIAGEN, # 74134).
-
bioRxiv - Molecular Biology 2023Quote: ... 27 with minimal modifications on gDNA extracted using the Gentra Puregene Cell Kit (Qiagen) from two independent human T cell (CD3+ ...
-
bioRxiv - Microbiology 2023Quote: ... and cells were harvested by centrifugation for RNA extraction using RNeasy Mini Kits (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... skin Ebf2- PαS cells and BM MSCs were isolated with RNeasy Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: RNA was extract from 8 x 106 cells using the RNeasy Mini Kit (Qiagen) protocol ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA was isolated from each cell line with the RNeasy Plus Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from frozen cells using the RNeasy Mini kit (74104, Qiagen). Cells were resuspended as per manufacturer’s instructions for RNAse-rich cell lines using 2-MercaptoEthanol (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were lysed and RNA was isolated using the RNEasy Plus mini kit (Qiagen) or the E.Z.N.A.® HP Total RNA Kit (Omega BioTek) ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA from edited cells was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and the percent edited alleles measured for an in-out PCR product ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was amplified with the REPLI-g Advanced DNA Single Cell Kit (Qiagen), and successful amplification of chytrid DNA was verified by PCR with the primers ITS4ngsF (5’-GCATATCAATAAGCGSAGGA-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Harvested cells were re-suspended in 800 μl RLT buffer (RNeasy Mini Kit, Qiagen) with β-mercaptoethanol (10 μl ml-1 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from tumor cell pellets using RNeasy Mini Kit (Qiagen, 74106) and RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from each cell line using a RNeasy Mini Kit (Qiagen). cDNA was synthesized with a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted form cells using the RNAeasy Mini preparation Kit (Qiagen, UK). Total RNA was measured by Nano-drop spectrophotometer 0.1-0.5 μg of total RNA was used to produced cDNA ...
-
bioRxiv - Immunology 2023Quote: ... total RNA was isolated from 1x 106 cells using the RNeasy Mini kit (Qiagen) and digested with DNase I ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from cell pellets using QiaAMP DNA Mini Kit (Qiagen, 51306). Barcodes were PCR amplified using 5’- GATATTGCTGAAGAGCTTG and 5’- CCAGAGGTTGATTGTTCCAGA ...
-
bioRxiv - Bioengineering 2022Quote: Genomic DNA was extracted from monoclonal cells using DNeasy Blood and Tissue kit (Qiagen) following the instructions ...
-
bioRxiv - Genetics 2023Quote: ... Cells were harvested 72 hours after transfection using the RNeasy Plus Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... while RNA from cell monolayers was extracted using the Rneasy Plus Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated 5x106 cells using the RNAeasy Plus Mini kit (Qiagen, #74134). PolyA enrichment ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA of mutant cells was isolated using DNA Blood Mini Kit (QIAGEN, 51106) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: The total RNA in cells were extracted using RNeasy® Mini Kit (#74106 Qiagen) and the concentration and purity of the RNA were measured by nanodrop spectrometer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were harvested and RNA extraction was performed using the RNeasy Kit (Qiagen, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell pellets were resuspended in RLT lysis buffer from the RNeasy Mini Kit (Qiagen) and stored at −80°C until sufficient samples for three biological repeats had been collected ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was first isolated from the cells using the RNeasy Mini Kit (#74104, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: We first extracted total RNA from cells using the Qiagen RNEasy kit(Qiagen 74004). We generated cDNA from the total RNA using the RDRT reagent (Sigma RDRT-100RXN ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from biological triplicate cell pellets using RNeasy Mini Kit (Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from cell lines using RNeasy Plus Mini Kit (QIAGEN, Cat. # 74134). Isolated RNA was used (1 μg ...
-
bioRxiv - Cancer Biology 2022Quote: Assays were performed in 293T cells using Cignal RARE Reporter Assay Kit (Qiagen 336841) as described previously (9).
-
bioRxiv - Cell Biology 2023Quote: ... and RNA was extracted from the cell pellets by RNeasy® Mini kit (QIAGEN) following the manufacturer protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... total RNA was extracted from cell lysate by RNeasy Plus Mini Kit (Qiagen, 74136). Total RNA which was carried out following the method described above was removed rRNA by rRNA Depletion Kit (Vazyme ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA of edited cells was extracted using Blood & Tissue Kit (Qiagen, Cat# 69506). The UMI labeling was performed followed the published protocol 7 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted from cells and mouse tumors using the miRNeasy kit (Qiagen, #217004) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted from cell pellets using the RNeasy Plus mini kit (Qiagen #74136) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted from sorted cells using RNeasy Mini Kits (Qiagen, Hilden, Germany), and the quality of the RNA was evaluated using an Agilent Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA was extracted from cell pellets using the QIAamp Blood Maxi Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from 22Rv1 cells via RNeasy Mini Kit (QIAGEN, no. 74106). Messenger RNA was purified from total RNA using poly-T oligo-attached magnetic beads ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was extracted from cell monolayers with the RNeasy mini kit (Qiagen, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were lysed and RNA was purified using the Qiagen RNeasy kit (Qiagen, # NC9677589). Purified RNA was stored at –20°C until use.
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated from cells using the Qiagen RNeasy kit (Qiagen, Valencia CA). The isolated RNAs (20 ng ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA of cultured cells was isolated using the RNeasy Plus Mini Kit (Qiagen, 74136 and 200-500 ng of total RNA was used to synthesize cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The total RNA from the cell candidates was isolated with RNeasy Micro Kit (Qiagen) and converted to cDNA using iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: Cells were harvested for total protein using a Qproteome Mammalian Protein Prep Kit (Qiagen). Total protein was quantified using a PierceTM BCA Protein Assay Kit (Cat ...