Labshake search
Citations for Qiagen :
2001 - 2050 of 3031 citations for 6 1 Aminoethyl 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified bacterial lysates from a 1 l culture were bound to a 0.5 ml column of Ni-NTA resin (Qiagen) by gravity flow ...
-
bioRxiv - Genetics 2023Quote: ... leaf tissues were collected and homogenized in 400 μL of TPS buffer (100 mM Tris-HCl, 10 mM EDTA, 1 M KCl, pH8.0) using TissueLyser II (Qiagen), followed by incubation for 20 min at 75°C ...
-
bioRxiv - Immunology 2023Quote: ... Primers were designed using the NCBI primer-designing tool (see Table 1) or ordered as validated primers from Qiagen. The mRNA expression levels were plotted as relative gene expression to β-actin (2-ΔCt) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was analyzed on an agarose gel (1%) and purified by using the QIAquick gel extraction kit (Qiagen #28706). DNA was then digested and primer dimers were ligated at 16°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA (1 μg) was treated with DNase and converted into cDNA using the QuantiTect Reverse Transcription kit (Qiagen), according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated with Angiotensin-II (1 μM) alone or in combination with DAPT (10 μM) or siNotch1 (Qiagen) (50 nM ...
-
bioRxiv - Bioengineering 2023Quote: ... total RNA was extracted from about 1 × 106 cells from all groups using RNeasy Mini Kit (Qiagen, Valencia, CA), then using the random hexamer primer and M-MuLV reverse transcriptase kit (Fermentas ...
-
bioRxiv - Developmental Biology 2023Quote: Blastocysts were washed with DPBS containing 1 mg/ml polyvinylpyrrolidone (PBS-PVP) and transferred into 50 μl droplets of 0.1% protease (Qiagen) to remove the zona pellucida ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted by incubation with 6 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, 1% SDS, 0.1 mg/ml proteinase K (Qiagen, 19131)) at 55°C for 16 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... V2 and V3 amplicons were resolved in the 1% agarose gel and purified using the gel purification kit (Qiagen). Each cDNA was cloned into pDONR201 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA (gDNA) was extracted from J-Lat cells 10.6 and HIV-1 negative CD4+ T cells with the QIAcube (Qiagen), using the QiaAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Rainbow proviral HIV-1 DNA dPCR assay was performed on a QIAcuity Four digital PCR platform (Qiagen, Germany) with at least 500 ng (CD4+ T cell ...
-
bioRxiv - Immunology 2023Quote: ... and approximately 1 µg of isolated RNA was converted to cDNA using RT2 First Strand Kit (Qiagen, Hilden, Germany). cDNA was diluted (1:10 ...
-
bioRxiv - Systems Biology 2023Quote: ... Large fragments (200-400 bp) were extracted from a 1% agarose gel with QIAquick Gel Extraction Kit (Qiagen, Netherlands). The final library was sequenced as 85 bp long single-end reads on a NextSeq™ 550 (Illumina ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Cancer Biology 2024Quote: ... doxycycline was added at (0.1 μg/ml, 1 μg/ml (CHRDL2 +) or 10 μg/ml (CHRDL2 ++) RNA was extracted (RNeasy, QIAGEN) and quantified by real-time reverse transcriptase polymerase chain reaction (qPCR ...
-
bioRxiv - Genomics 2023Quote: ... 1×106 cells were harvested from each culture and DNA was extracted using QIAamp DNA mini Kit (QIAGEN 51304). STR analysis was performed with PowerPlex 21 System (Promega DC8902 ...
-
bioRxiv - Immunology 2023Quote: The post-caval lobe of the lung was weighed and homogenized in 1 mL of PBS (pH 7.4) using a TissueLyser LT (Qiagen). RNA was extracted using TRIzol™ LS Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Undifferentiated myoblasts (day 0) and differentiated myotubes (day 7) were collected and lysed in 1 mL of Qiazol (Qiagen). RNA from undifferentiated and differentiated myoblasts was extracted using the Qiagen miRNeasy kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Physiology 2024Quote: ... RNA (1 μg, quantified via Nanodrop-2000 spectrophotometer) was transcribed to cDNA using the QuantiTect Reverse Transcription kit (QIAGEN) and stored at -20°C prior to analysis ...
-
bioRxiv - Plant Biology 2024Quote: ... four leaf discs (1 cm in diameter) were snap frozen in liquid nitrogen and powdered using a TissueLyser (QIAGEN). Total proteins were extracted from the powder using 400 μL GTEN buffer (10% glycerol ...
-
bioRxiv - Plant Biology 2024Quote: ... and ground for 1 min at 30 Hz with the pre-cooled Retsch Mill (Tissue Lyser II, Retsch, Qiagen). For quantification of S ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 µg of total RNA using the RT2 First Strand Kit (Qiagen, Germantown, MD, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... and were then incubated with or without triton-x (1% v/v) and with or without Rnase-A (Qiagen #19101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was used to synthesize cDNA using a QuantiNova Reverse Transcription kit (205410, Qiagen, UK). qPCR was performed using QuantiNova SYBR green (208052 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 1-2 flies per sample were homogenized in 100 μL phosphate buffer (pH 7.5) using a TissueLyser LT (Qiagen) with 5-mm stainless-steel beads ...
-
bioRxiv - Microbiology 2024Quote: ... DNA on the exterior of filtered capsids was digested for 1 h at 25°C with 20.3 units DNase (79254; Qiagen) supplemented with 10 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 MES or CP cells were harvested and RNA extraction was performed using Rneasy mini plus kit (Qiagen). 1 μg of total RNA was used for the construction of sequencing libraries and sequencing.
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 500 µl of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized during 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then washed 3 times with PBS and lifted with 500µL/well of Cell Protect Reagent (Qiagen) for 5 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...