Labshake search
Citations for Qiagen :
2001 - 2050 of 2928 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Reverse transcription was carried out using the miRCURY LNA™1 RT Kit (Qiagen) using 10 ng of RNA according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was isolated from 1 million cells using the RNeasy Mini kit (Qiagen), according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1 kb band was purified using the Qiaquick Gel Extraction Kit (Qiagen) and cloned into pCR2.1 TOPO cloning vector ...
-
bioRxiv - Plant Biology 2023Quote: ... per 1 ml buffer RLC and on-column Dnase digestion with Dnase I (Qiagen). First-strand cDNA was synthesized from 1 μg of total RNA using a Thermo Scientific RevertAid RT Kit (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Total RNA was collected and purified using the RNeasy Mini Kit Part 1 (Qiagen). The total RNA concentration was quantified using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... and the pellet was resuspended in 1 ml of RNA protect bacteria reagent (Qiagen). Then ...
-
bioRxiv - Pathology 2024Quote: ... was used to transfect HMEC-1 with siRNA control or siRNA MC1R oligonucleotides (Qiagen) (20 nM final concentration).
-
bioRxiv - Microbiology 2024Quote: ... The lysates were incubated with 1 ml of prewashed Ni-NTA Agarose beads (QIAGEN) for 1.5 h at 4 °C ...
-
bioRxiv - Genomics 2024Quote: ... The product was purified from a 1% agarose gel (QIAquick Gel Extraction Kit, Qiagen). The oligo pool was then ligated into 200 ng of the linearized plasmid in a 1:10 (vector:insert ...
-
bioRxiv - Immunology 2024Quote: ... HIV-1 RNA was extracted from plasma using the Viral RNA Mini Kit (Qiagen) and quantified by real-time PCR with the TaqMan® Fast Virus 1-Step PCR kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from 1 × 106 cells using RNeasy Plus Mini Kit (Qiagen) with genomic DNA removal ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription of 1 μg RNA was performed using Omniscript RT kit (Qiagen, #205111). CLN3 transcript was amplified ...
-
bioRxiv - Immunology 2024Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (−80°C) ...
-
bioRxiv - Neuroscience 2024Quote: ... we harvested 1 Mio cells or one organoid in RLT buffer (#74104, Qiagen, Germany). cDNA was synthesized with the RevertAid Reverse Transcriptase kit (EP0442 ...
-
bioRxiv - Neuroscience 2024Quote: ... for GST-tagged CMK-1 variants or nickel-nitrilotriacetic acid beads (Ni-NTA, Qiagen) in the presence of 15 mM imidazole for TAX-6-His6 protein binding ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cleavage reactions were stopped by adding 1 μl Proteinase K (20 mg/ml) (Qiagen) and followed by incubation at room temperature for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... The products were purified from a 1% agarose gel (QIAquick Gel Extraction Kit, Qiagen) and ligated by Gibson with 3 h of incubation at 50°C followed by dialysis for 3 h on a membrane filter (MF-Millipore 0.025 μm membrane ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 μL RNA lysis buffer consisting of 1% β-mercaptothanol in RLT Plus (Qiagen) was added to the beads ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein in the soluble lysate was bound to 1 mL Ni-NTA resin (Qiagen), washed with 5 mL low salt wash buffer (20 mM Tris HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... genomic DNA was harvested from 1×106 cells using the Puregene Cell Kit (Qiagen). DNA was diluted to 100 ng/µl in 0.4 M NaOH and 10 mM EDTA (pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was isolated from 1×106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MCD360-1 and the F1 progenies using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Equal amounts of DNA were pooled from 30 responsive as well as 30 non-responsive progenies for the INF1 recognition phenotype and 29 responsive and 30 non-responsive individuals for the SCR74 response phenotype ...
-
bioRxiv - Biochemistry 2021Quote: ... and the membrane suspension was mixed with 1 ml of Ni-NTA Superflow resin (Qiagen) per 1mg of GFP–His8 and incubated for 3 hours at 4 °C ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from ∼1 M cells using the QIAGEN RNeasy Mini Kit (QIAGEN 74104). A total of 36 samples were prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... with all primers listed in Supplementary Table 1 and then purified (QIAGEN, PCR purification kit). Before nick translation ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 μg total RNA was reverse transcribed using the miScript II Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions (Jay and Ciaudo ...
-
bioRxiv - Microbiology 2020Quote: ... Cell debris were eliminated by centrifugation and 1 mL of Ni-NTA superflow beads (Qiagen) was added to bind his-tagged proteins ...
-
bioRxiv - Physiology 2021Quote: ... 20 μL reactions consisted of 1×QuantiFAST reaction mix containing ROX reference dye (Qiagen, Germany), 0.66 µM of forward and reverse primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse cross-linking was performed by the addition of 0.2 mg ml-1 RNaseA (Qiagen) and 0.2 mg ml-1 Proteinase K (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the sample at a 1:1000 dilution in RNAse-free water (Qiagen, 129112) (2017) ...
-
bioRxiv - Molecular Biology 2022Quote: The supernatant was mixed with 1 ml resin volume of Ni-NTA beads (Qiagen, 30210) which was pre-equilibrated with Lysis buffer supplemented with 40 mM imidazole and 0.1 mM ATP ...
-
bioRxiv - Plant Biology 2022Quote: ... The lower part of the root (1 cm) was collected directly in RLT buffer (QIAGEN) and frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was prepared from 0.5-1 μg RNA using a Quantitect Reverse Transcription Kit (Qiagen) and diluted to 2.5 ng/mL in DEPC-treated water ...
-
bioRxiv - Cancer Biology 2022Quote: Cells from knockdown control or shWDR5-1 group were harvested with QIAzol Lysis Reagent (Qiagen) and homogenized using QIAshredder tubes (Qiagen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the supernatant was purified by 1 mL Ni2+ IMAC with Ni-NTA Superflow resins (Qiagen). Resins with bound cell lysate were washed with 10 mL (bed volume 1 mL ...