Labshake search
Citations for Qiagen :
2001 - 2050 of 3514 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... PBS) using a 5 mm stainless steel bead at 30 hertz for 45 seconds in a TissueLyser II (Qiagen). Samples were then centrifuged at 10,000 rcf for 10 minutes at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNA as above (Lap2: 5’-GAUGUGACAGAGCUCUCUA from Sigma; negative control: AllStars negative control from Qiagen). Total RNA was extracted with a Nucleospin RNA kit from Macherey-Nagel according to the manufacturer’s protocol from triplicates of control and Lap2-depleted samples ...
-
bioRxiv - Immunology 2021Quote: ... viable in vitro differentiated CD4+ T cells were sorted into 96-well plates containing 5 μl TCL Buffer (QIAGEN) with 1% 2-mercaptoethanol ...
-
bioRxiv - Immunology 2020Quote: ... which contained 5 μl of sort buffer consisting of (1X Qiagen One-step RT PCR Buffer (Qiagen, Hilden, Germany), 0.1 mM dithiothreitol (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... The filtrated supernatant containing His-thioredoxin-ApoE was applied to a 5 ml Ni-NTA Superflow Cartridge (Qiagen, Germany) pre-equilibrated with TBS buffer A ...
-
bioRxiv - Biochemistry 2023Quote: ... The sonicate was centrifuged at 38,000 × g for 30 min and the supernatant was loaded on a Ni-NTA agarose column (2.5 × 5 cm, Qiagen) pre-equilibrated with buffer (50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysates were clarified by centrifugation at 24,000 g for 30 min and applied to a 5 mL column bed of Ni-NTA resin (Qiagen) for purification by IMAC ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Plant Biology 2023Quote: ... and 20 ng cDNA were subjected to the Rotor-Gene Q 5-Plex HRM real-time PCR system (Qiagen), using the default program ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was loaded onto a 10 mL Ni-NTA Superflow cartridge (connected two 5 mL cartridges) (30761, Qiagen). The cartridge was washed with 100 mL R buffer containing 200 mM NaCl ...
-
bioRxiv - Biochemistry 2022Quote: ... Soluble fraction was recovered by centrifugation at 40 000 × g in a JLA25.50 rotor and put through a gravity flow column with 5 ml of NiNTA Agarose (Qiagen). Bound fraction was washed in Buffer B (300 mM NaCl ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants were filtered through a 0.22 µm syringe filter before application to 5 ml of nickel resin (Ni-NTA Superflow, QIAGEN) equilibrated in loading buffer (25 mM HEPES-KOH pH 7.6 ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was pelleted by centrifugation at 30,000 x g for 30 min and the supernatant was mixed with 5 mL Ni-NTA resin (Qiagen) pre-equilibrated with lysis buffer in a 50 mL falcon tube ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was filtered through a 0.45 µm syringe filter and applied to a 5 ml Ni-NTA agarose column (Qiagen) pre-equilibrated in Lysis-Wash buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR reactions were set up in duplicate in the Rotor-Gene Q thermocycler 5 plex (Qiagen, Germantown, MD, USA). Primers reported here were designed using Primer BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 5-10×106 cells using the Gentra Puregene Cell Kit (Qiagen, cat no. 158046) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Transformants were grown to saturation in 5-8mL of LB media supplemented with ampicillin (100µg/mL) and miniprepped (Qiagen) for Sanger sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by centrifugation at 20,000 x g for 30 min and loaded on a 5 ml Ni-NTA Superflow column (QIAGEN) followed by extensive washing ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA and RNA from healthy tissues and lymphomas of control and STIL-transgenic mice was extracted using the All Prep DNA/RNA/Protein Mini Kit according to manufacturer’s instructions after tissue homogenization using TissueLyser II and stainless-steel beads (5 mm, all Qiagen). DNA and RNA concentrations were quantified with Qubit 2.0 using the dsDNA High Sensitivity and RNA High Sensitivity Kit (both Thermo Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrated supernatant containing His-tagged NanoLuc was applied to a 5-mL Ni-NTA Superflow Cartridge (Qiagen, Germany) pre-equilibrated with TBS buffer A ...
-
bioRxiv - Genetics 2023Quote: ... medium was removed using the Bluewasher (BlueCatBio) and cells were lysed for 5 min using RLT plus buffer (Qiagen), snap frozen on dry ice and stored at −80 °C ...
-
bioRxiv - Immunology 2022Quote: ... Enriched cells were surface stained and 5-20 ×103 intratumoral cDC1s were sorted directly in RLT lysis buffer (Qiagen) containing 2-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transcribed cDNA was diluted 5-fold and used for real-time quantitative PCR (QuantiTect SYBR Green; Qiagen ref: 204145). RNA-sequencing libraries were produced with the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina (E7770) ...
-
bioRxiv - Developmental Biology 2022Quote: Ovarian total RNA was extracted from 5 μl freshly dissected fly ovaries by using Qiagen RNeasy Purification Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... VDAC1P8-201 and GAPDH (Suppl. Table 5) and 12.5 μl of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Analysis of relative expression level was performed using the housekeeping GAPDH gene as internal calibrator by the ΔΔCt method ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from approximately 25-50 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were then incubated in lysis buffer (DPBS with 0.5% Triton X-100, 10 mM MgCl2, 5 mM CaCl2, 100 µg/mL RNAse A (Qiagen)) overnight at 37°C in a water bath to allow capsid maturation ...
-
bioRxiv - Microbiology 2023Quote: ... Lysate was centrifuged (6000rcf, 5 minutes) and genomic DNA (gDNA) extracted from pellets also using the DNeasy kit (QIAGEN). Successful gene modification events or maintenance of the wildtype loci was performed by PCR using primers listed in Table S5.
-
bioRxiv - Genetics 2024Quote: Total mRNA was isolated from 6 hpf to 5 dpf zebrafish homogenates using an RNeasy Mini Kit (Qiagen, 74106) and reverse-transcribed with iScript (Bio Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... was run on an Applied Biosystems Quant Studio 5 machine using RT2 SYBR Green ROX Mastermix (catalog: 330521; Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells transfected with dsRNA were harvested after 5 days and RNA was extracted using the RNeasy Micro Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were then incubated in lysis buffer (DPBS with 0.5% Triton X-100, 10 mM MgCl2, 5 mM CaCl2, 100 µg/mL RNAse A (Qiagen)) overnight at 37°C in a water bath to allow capsid maturation ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was collected and filtered through a 0.2 μm asymmetric polyethersulfone membrane and applied to a 5 mL Ni-NTA Superflow cartridge (QIAGEN). The His- tagged SsdA protein was eluted with a linear concentration gradient of imidazole and further purified by size-exclusion chromatography (SEC ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysates were clarified by centrifugation at 30,000 g for 30 min and applied to a 5 mL column bed of Ni-NTA resin (Qiagen) for purification by IMAC ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR reactions for genes of interest were performed on a QIAquant 96 well 5 plex qPCR machine (Qiagen, 9003010). Using PrimeTime qPCR probe assays (IDT ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was isolated from 1×106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MCD360-1 and the F1 progenies using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Equal amounts of DNA were pooled from 30 responsive as well as 30 non-responsive progenies for the INF1 recognition phenotype and 29 responsive and 30 non-responsive individuals for the SCR74 response phenotype ...
-
bioRxiv - Biochemistry 2021Quote: ... and the membrane suspension was mixed with 1 ml of Ni-NTA Superflow resin (Qiagen) per 1mg of GFP–His8 and incubated for 3 hours at 4 °C ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from ∼1 M cells using the QIAGEN RNeasy Mini Kit (QIAGEN 74104). A total of 36 samples were prepared ...