Labshake search
Citations for Qiagen :
1951 - 2000 of 3437 citations for Fipronil 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... total RNA was harvested from BMDM 4 hours post-treatment per Qiagen RNA extraction protocol (QIAGEN). RNA was then reverse transcribed to cDNA using iScript Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA extractions were performed with the MagAttract PowerSoil DNA kit (Qiagen, Cat. No. 27000-4-KF) optimized for the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA of ASFV was extracted from the known viral titer of 107 HAD50/ml (50 percent haemadsorbing dose per ml) using the QIAamp DNA Mini Kit (Qiagen, USA). Extracted DNA was then serially 10-fold diluted and 1 μl of the diluted DNA was added to the LAMP reactions.
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Biochemistry 2021Quote: Purified CrFBA3 was tested for crystallization at two concentration of 9 mg/ml and 4.5 mg/ml on commercial sparse-screening conditions (Qiagen, Hilden Germany) based on the work of Jancarik and Kim (Jancarik ...
-
bioRxiv - Microbiology 2024Quote: ... RNA samples were initially preserved with 1 mL of activated sludge (i.e., suspended phase) in 9 mL of LifeGuard Soil Preservation (Qiagen, Hilden Germany). This solution was thawed and centrifuged (16,000 g for 1-minute ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (2 mL/min flow rate) was prepared with 15 mL nickel resin (Qiagen #30230), followed by equilibration with 50 mL Nickel A Buffer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... were homogenised in QIAzol reagent (1 mL) in a 2 mL safe lock tube with stainless steel beads using a TissueLyser II homogeniser (Qiagen, UK) at 30 Hz until fully homogenised (1-2 min) ...
-
bioRxiv - Immunology 2021Quote: ... or 100 nM AllStars Negative Control siRNA (siNC) using HiPerFect transfection reagent (both from Qiagen). One day after transfection ...
-
bioRxiv - Genetics 2020Quote: ... and HMW DNA was extracted using the QIAGEN Genomic tip 100/G kit (Qiagen, Germany). For PacBio Sequel an EgII line was created with single pair crossing and subsequent sibling-mating for six generations ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 100 mg plant material using the RNeasy plant mini kit (Qiagen). RNA was checked and sequenced according to (Brilhaus ...
-
bioRxiv - Plant Biology 2020Quote: ... About 100 mg frozen plant material were pulverized in a tissue lyser (Qiagen, Hilden, Germany) at 30 Hz for 90 sec ...
-
Individual differences in honey bee behavior enabled by plasticity in brain gene regulatory networksbioRxiv - Genomics 2020Quote: ... The remaining 100 μL homogenate was mixed with 500 μL RLT buffer (Qiagen, Hilden, Germany) with 1% β-mercaptoethanol for use in the Qiagen RNeasy Mini Kit RNA extraction protocol (see below).
-
bioRxiv - Systems Biology 2020Quote: ... The entire oligo pool (lyophilized, 10 pmol) was dissolved in 100 μ! Elution buffer (Qiagen) and shaken at room temperature (RT ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μl of blood was added to 600 μl of AVL viral lysis buffer (Qiagen) for virus inactivation and RNA extraction ...
-
bioRxiv - Cell Biology 2021Quote: mRNA was extracted from worms (∼100) and cells (105∼106) using the RNeasy kit (Qiagen). 1 µg mRNA was used for subsequent reverse transcription using the SuperScript III First-Strand Synthesis SuperMix (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pylori selective agar (in-house recipe) with the Genomic Tip 100/G (Qiagen, Hilden, Germany). Nextera XT libraries were generated and sequenced in three different runs on MiSeq 2×300bp paired (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: Tissues (100 mg) were homogenized into powders using a TissueLyser II (Qiagen, Valencia, CA, USA). DNA was extracted using the DNeasy Plant kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μl of blood was added to 600 μl of AVL viral lysis buffer (Qiagen) for virus inactivation and RNA extraction ...
-
bioRxiv - Genomics 2022Quote: ... Nuclei (<30,000) were collected into 100 μl of Buffer AL (QIAamp DNA Micro Kit, QIAGEN) and immediately lysed by pulse-vortexing ...
-
bioRxiv - Physiology 2019Quote: Total islet RNA (100–200 islets/mouse) was extracted using the RNeasy Mini Kit (Qiagen). RNA concentration and integrity were assessed using the ND-1000 Spectrophotometer (NanoDrop) ...
-
bioRxiv - Systems Biology 2019Quote: ... 250μl 100% ethanol and loaded onto an RNeasy column from the RNeasy Kit (Qiagen, Germany). RNA was then washed and eluted following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... mixed with 600 μl of 100 % ethanol and loaded onto an RNeasy-spin column (Qiagen) for RNA extraction and additional on-column DNA digestion following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... was used for robot extractions while the Qiagen DNeasy PowerSoil kit (Qiagen, Cat# 12888-100) was used for ‘manual ...
-
bioRxiv - Genomics 2019Quote: ... The cell lysate was sampled (100 μL) and mixed with 700 μL of QIAzol (QIAGEN) for total RNA extraction ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 ng of DNA was first purified using a QIAquick PCR purification kit (Qiagen, Japan) according to the manufacturers’ protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA pellets were air dried and resuspended in 100 μL Buffer EB (Qiagen, Hilden, Germany).
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from the isolated nuclei pellets using the Qiagen Genomic tip-100 (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was isolated with a Qiagen genomic DNA 100/G kit (Qiagen, Hilden, Germany) with modifications to the ‘Part I sample preparation and lysis protocol for yeast’ of the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... before proceeding according to the protocol and eluting in 100 µL of elution buffer (Qiagen). DNA yields are quantified via fluorometry (Qubit 2.0 ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from ±100 mg ground tissue using the RNeasy Plant Mini Kit (Qiagen). Four biological replicates ...
-
bioRxiv - Immunology 2022Quote: ... with β-mercapto-ethanol (1:100) and RNA was extracted using RNeasy micro kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... before proceeding according to the protocol and eluting in 100 µL of elution buffer (Qiagen). DNA yields were quantified via fluorometry (Qubit 2.0 ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA of whole tissue was extracted using QIAGEN Genomic-tip 100/G (QIAGEN, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... ChIP-DNA was treated with 250 μL 1X TE containing 100 μg RNase A (Qiagen) and 5.0 μL of 20 mg/mL Proteinase K (ThermoFisher Scientific ...