Labshake search
Citations for Qiagen :
151 - 200 of 2200 citations for tert Butyl 3 5 2 amino ethyl thiophen 3 yl propionate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2024Quote: ... was added to each tube and homogenized at 30 rev/s for 3 minutes for 2 rounds using a tissue homogenizer/lyser (#9003240, Qiagen). Kidney extracts were centrifuged at 17,000 RCF for 10 minutes and the supernatant was transferred to a 1.5 mL microcentrifuge tube and kept over ice for 1-2h ...
-
bioRxiv - Genetics 2024Quote: ... yeast plasmid DNA was extracted from 5x107 cells harvested off of galactose and final glucose plates of replicates 2 and 3 using Qiaprep Spin Miniprep Kit (QIAGEN). We amplified the 200-bp repair template region from the initial E ...
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Cell Biology 2024Quote: Hand SFs were transfected with 50 nM antisense LNA targeting HOXD10 (Qiagen, Sequence: 5′-TGT CTG CGC TAG GTG G-3′), HOXD11 (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Plant Biology 2020Quote: Reduced His-tagged PRX-IIE (3 mg) or PRX-IIE C146S (3 mg) were bound to 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) and used as affinity matrix ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... using 3-mm steel beads (Cat No.: 69997, Qiagen); tubes were shaken for 20-s at 28 Hz with dry ice.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two sterile 3 mm beads (Qiagen, Hilden, Germany) and a bead device at 20 Hz for 3 min ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 3 volumes RLT buffer (Qiagen) and RNA was extracted using Dynabeads MyOne Silane (Life technologies) ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 min in TissueLyser II (30 Hz; Qiagen). Cell lysates were centrifuged for 15 min (4 °C ...
-
bioRxiv - Immunology 2023Quote: ... using tungsten carbide beads (3 mm, Qiagen catalog #69997) and shaking (300 times per min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 µl of cell extracts ...
-
bioRxiv - Physiology 2023Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). Lysates were centrifuged for 15 min (21,000 g ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Developmental Biology 2024Quote: ... and agarose gel electrophoresis from genomic DNA isolated 2-3 days after electroporation using the DNeasy Blood & Tissue Kit (Qiagen 69506). 24 hr after electroporation ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from hESCs approximately 52 hr (day 2) or 74 hr (day 3) after starting the cardiac differentiation protocol using the RNeasy Mini Kit (QIAGEN 74106) from at least two independent biological replicates per sample ...
-
bioRxiv - Microbiology 2024Quote: Total RNA of the supernatants collected from SARS-CoV-2 infected Calu-3 cells 48 h post-infection were isolated using the QIAamp Viral RNA Mini Kit (Qiagen; #52906) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Blood was obtained for lymphocyte preparation 3-5 days after the fifth immunization and RNA was prepared from lymphocytes using the RNeasy kit (Qiagen, Valencia, CA). A VHH-display phage library was prepared essentially as described previously [70] following each of the rounds of alpaca immunization ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2024Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Plant Biology 2021Quote: ... and sunflower_KTI _R (5’ – CTACTCAGATTGAACAGAAGCCAC- 3’were designed and used in a PCR reaction with total DNA extracted (DNeasy Plant Mini Kit, Qiagen, Valencia CA USA) from sunflower leaf tissue ...
-
bioRxiv - Immunology 2023Quote: Whole livers were harvested at indicated timepoints and placed into a 7 ml homogenizer tube (Omni International Cat. No. 19-651) containing 3 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Spleens and single granulomas were harvested at indicated timepoints and placed into a 1 ml homogenizer tube (Fisher Brand Cat ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Genomics 2024Quote: ... Then the total volume was spun down and plasmid pools were extracted from the bacterial pellets using 2-3 columns of the Hi-Speed Plasmid Maxiprep kit (Qiagen, catalog no. 12663) per sublibrary ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg target vector using PolyFect transfection reagent (Qiagen, 301107). Media containing virus was collected both 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Virus Precipitation Solution (System Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3 min at 50 Hz using a TissueLyser LT (Qiagen) with 1 min incubation on ice in between homogenisations ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs targeting the 3’UTR of Arhgap11a were purchased (siRNAflex, Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was incubated with 3 ml Ni-NTA resins (QIAGEN) with gentle agitation at 4 °C for an hour ...
-
bioRxiv - Bioengineering 2023Quote: ... containing 3 μL 4X Probe PCR Master Mix (250102, Qiagen, USA) (final concentration 1X) ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated with binding buffer (50 mM Tris-HCl pH 8.0 ...