Labshake search
Citations for Qiagen :
151 - 200 of 792 citations for TGFB3 Human Mouse Rat HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The gene array reaction was performed using the RT2 Profiler™ Rat Synaptic Plasticity PCR Array (Cat. No. 330231, Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Single alanine substitutions were introduced throughout the α1M2-M3 linker from L276-T283 in addition to the gain of function α1L9’T pore mutation (rat α1L263T) (QuikChange II, Qiagen). Each construct was verified by forward and reverse sequencing of the entire gene ...
-
bioRxiv - Genomics 2019Quote: ... FSM sub-groups and 12 rats in the CS sub-group) using the RNeasy Plus Mini Kit (Qiagen, Hilden Germany). RNA extraction ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from ≈10 mg of MCT rat lung tissues using the RNeasy Fibrous Tissue Mini Kit (74704, Qiagen) following to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Primary mouse CD4+ T cells were purified from lymph nodes and spleens by negative selection using anti-MHCII and anti-CD8 hybridoma supernatants (M5/114 and 2.43, respectively) and anti-rat Ig magnetic beads (Qiagen BioMag). The resulting CD4+ T cells were then immediately activated on 24-well plates coated with anti-CD3 and anti-CD28 (1 ug/ml each ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: DNA and RNA were extracted from rat liver using the All Prep DNA/RNA/miRNA Universal Kit (Qiagen, Hilden, Germany) using the manufacturer’s instructions for ‘Simultaneous Purification of Genomic DNA and Total RNA from Animal and Human Tissues’ with no alterations ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from 700,000 to 1.25 million RGCs from 4 independent rat litters per developmental stage was isolated using the Qiagen RNAeasy kit from Qiagen, which included a 15 minutes On-column DNAse step ...
-
bioRxiv - Neuroscience 2023Quote: The extraction and purification of adult Sprague-Dawley rat RNA was performed using a RNeasy Mini Kit (Qiagen, Germantown, MD). cDNA was obtained using High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was isolated from 1 mm3 mouse and naked mole-rat back skin biopsies and livers using a modified and combined version of the AllPrep DNA/RNA Micro Kit (Qiagen) and DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genetics 2021Quote: Human genomic DNA (gDNA) was extracted using the QIAamp DNA Mini Kit (QIAGEN, Germany) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... pallidum and human RNase P gene (RNP) using a Rotor-Gene 6000 instrument (Qiagen) as previously described with modifications (11 ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Immunology 2021Quote: ... total RNA of CD8+ human T cells was extracted by miRNeasy Mini Kit (Qiagen), following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and human islets were isolated using RNeasy Mini or Micro kits (Qiagen; Valencia, CA). Reverse transcription was completed with a High Capacity cDNA Reverse Transcription kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... rodent tissues and human samples using the Qiagen Blood and Tissue Kit (Qiagen, USA). The procedures prior to protein digestion were as follows ...
-
bioRxiv - Neuroscience 2022Quote: Cultured human T cells after treatment were flash frozen in Buffer RLT (Qiagen, 79216) and kept in −80°C until processing ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA from cultured human cells were isolated using the QIAamp DNA kit (Qiagen) and genomic DNA from MEFs and mouse tissue samples were extracted using the DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from human cells with an RNA purification kit (Qiagen, 74134) and genomic DNA was removed by genomic DNA binding columns in the kit ...
-
bioRxiv - Genomics 2019Quote: Dissociated human islets cells were transfected with scramble siRNA (Cat# 1027284, Qiagen, Toronto, Canada) or siRNA from ThermoFisher Scientific against OGDHL (ID# s31422) ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA was extracted from cultured human ECs using a RNeasy Mini kit (Qiagen). For reverse transcription ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or human ABCB1-transfected MDR-19 cells using the RNeasy Mini extraction kit (Qiagen). First strand cDNA synthesis was performed on 500 ng of template RNA using MMLV reverse transcriptase (fc 10 units/µl) ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
bioRxiv - Genomics 2024Quote: ... genomic DNA from human primary T cells was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from human islets using the miRNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from human cells using RNeasy Mini kits (QIAGEN, Hilden, Germany) and reverse transcribed using Super-Script III (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from primary human PTC with the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: A human mitochondrial energy metabolism PCR array (Qiagen RT2 Profiler PCR Arrays, PAHS-008YA) was performed from cDNA synthesized from 1 µg of total RNA from the tumors of control and CPI-613 treated mice ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Plin2 homology arms were obtained by extracting DNA from mouse primary mouse NSPCs from the SVZ using DNeasy Blood & Tissue Kit (#69506, Qiagen). The sequences covering the sgRNA target site were extracted from the genomic DNA using PCR ...
-
bioRxiv - Genomics 2022Quote: ... The DNA from mouse bladder tumors and matched germline DNA from mouse tails were extracted using the DNeasy Blood Tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal mouse Strep-tag antibodies (#34850, Qiagen), a monoclonal anti-actin antibody (A5441 ...
-
bioRxiv - Cell Biology 2020Quote: ... for mouse cells or the RNeasy kit (Qiagen) for human cells ...
-
bioRxiv - Cell Biology 2023Quote: ... or siRNA for Anxa2 (Mouse, Qiagen, Mm_Anxa2_3, SI00167496).
-
bioRxiv - Biochemistry 2023Quote: Mouse EL4 genomic DNA was isolated by QIAGEN Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse tissues were homogenized using TissueLyser II (Qiagen) and stainless-steel beads (5 mm ...
-
bioRxiv - Molecular Biology 2022Quote: Rat epididymal fat and liver tissue samples were lysed in RNA extraction buffer (RLT) from the RNeasy kit (Qiagen, Germantown, MD) with stainless-steel disruption beads for 4 minutes at 30.0 Hz using the Qiagen TissueLyser (Germantown ...
-
bioRxiv - Neuroscience 2022Quote: ... dsDNA binding dye (SYBR® green) chemistry-based qPCRs were performed on purified RNA samples using Rat GABA & Glutamate RT2 Profiler PCR arrays (Qiagen, Inc. ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...