Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for Superoxide Anion Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... validated assay to target UniSp6 (Qiagen product# 339306, catalogue# YP00203954) which is a cDNA synthesis/PCR control ...
-
bioRxiv - Immunology 2020Quote: ... Gene expression analysis was performed with primer assays from Qiagen [IL-10] and Eurofins [IL-12α ...
-
bioRxiv - Neuroscience 2023Quote: ... Pre-validated Qiagen QuantiTect Primer Assays (Qiagen, Germantown, MD, USA) were used for cut (QT00501389) ...
-
bioRxiv - Systems Biology 2024Quote: ... Gene expression was analyzed with predesigned QuantiTect primer assays (Qiagen) or custom-designed Primer (Suppl ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Developmental Biology 2023Quote: ... together with the miRCURY LNA miRNA PCR Assay (Qiagen, 339306) on a StepOne Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Cancer Biology 2021Quote: ... miScript primer assays for Hs_miR-22_1 and Hs_RNU6-2_11 from Qiagen were used.
-
bioRxiv - Cell Biology 2020Quote: ... mRNA expression level was evaluated using specific QuantiTect Primer Assays (QIAGEN) specific for NUPR1 (QT00088382) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... A2 and B Wolbachia using PyroMark Assay Design 2.0 (Qiagen, USA). A complete list of primers sequences could be found in Table S3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using SYBR Green QuantiTect Primer Assay (Qiagen) according to manufacturer’s instructions in a 7900HT Fast-Real Time PCR System Instrument (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primers (IDT) were designed using the PyroMark Assay Design software (Qiagen)
-
bioRxiv - Cancer Biology 2020Quote: ... The ChIP primers were purchased from Qiagen (EpiTect ChIP PCR assay) and used for qPCR analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the appropriate bespoke designed miScript Primer Assays (Qiagen, Crawley, UK). Real-time PCR was undertaken using a LightCycler® 96 system (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... AT2R qRT-PCR was performed using RT2 qPCR Primer Assay (Qiagen). AT2R ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers were designed with the PyroMark Assay Design 2.0 software (Qiagen), based on the Ensembl GRCh37 assembly (See Supplementary Table 10) ...
-
bioRxiv - Cell Biology 2023Quote: ... All primers were purchased from miScript Primer Assays (Qiagen, Valencia, CA) and GAPDH mRNA expression of each sample was used as normalization.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Genomic DNA was quantified using Qubit DNA Broad Range assay (Qiagen) and quality-checked by agarose gel electrophoresis before adjusting concentration to 150 ng/µl ...
-
bioRxiv - Neuroscience 2024Quote: ... miRCURY LNA assays for qPCR of miRNA were purchased from Qiagen, and TaqMan probes were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH was used as a control (Hs_Gapdh_3_SG QuantiTect Primer Assay, Qiagen). Each sample was tested in three technical replicates.
-
bioRxiv - Cell Biology 2022Quote: ... The individual miRNA assays used in this study were purchased from Qiagen and used with the miRCURY LNA miRNA PCR Starter Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... validated assay to target hsa-MIR-941 (Qiagen product# 339306, catalogue# YP00204574). Each 10µl reaction was made up of the following ...
-
bioRxiv - Neuroscience 2020Quote: ... with 1 µL cDNA using the following oligonucleotides (QuantiTect Primer Assays, Qiagen): Gli1 (Gli1 ...
-
bioRxiv - Immunology 2022Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Neuroscience 2020Quote: ... Mag and Mbp were designed using PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Figure 3 ...
-
bioRxiv - Developmental Biology 2019Quote: ... miRCURY LNA™ miRNA PCR Assays were designed and synthesized by Qiagen for miR-92a-3p as well as miR-19d-3p (miRBase accession ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pyrosequencing primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen). 500ng of genomic DNA was subjected to bisulfite conversion using the EpiTect Bisulfite Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Cancer Biology 2022Quote: ... SMNDC1 primers (Hs_SMNDC1_1_SG QuantiTect Primer Assay QT00014035) were from Qiagen (Hilden, Germany). PCR was performed with Hot Start Taq Polymerase (M0495S ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins used for inhibition assays were purified using Ni-NTA resin (Qiagen) followed by size exclusion column chromatography (ÄKTA pure ...
-
bioRxiv - Microbiology 2023Quote: ... QuantiTect Primer assays [ACTB (QT00095431) and CDKN1A (QT00062090)] we purchased from Qiagen. ACTB was used for normalization ...
-
bioRxiv - Bioengineering 2023Quote: ... and primers from miRCURY LNA miRNA PCR Assays (Catalog No. 339306, Qiagen) for hsa-miR-21-5p (GeneGlobe ID YP00204230) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Mm_miR-29c were the miScript primer assays pre-designed by Qiagen. The mature microRNA sequences were 5’UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a ...
-
bioRxiv - Cancer Biology 2024Quote: ... For two-way qPCR (analysis of MAPK11; Hs_MAPK11_1_SG QuantiTect Primer Assay, Qiagen); cDNA was first synthesised with High Capacity cDNA Reverse Transcription Kit (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Neuroscience 2022Quote: Primers used for expression studies were purchased from Qiagen (QuantiTect Assays, Hilden. Germany): Ccl2 (QT00167832) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR and sequencing primers were designed using the PyroMark Assay Design software (Qiagen). All successfully amplified PCR products were analysed on a PyroMark Q24 (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: All assays were performed on a real-time PCR (Rotor Gene Q, Qiagen). PCR reactions were set-up using the complementary QIAgility robotic pipettor (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... and β2-microglobulin (B2M) mRNAs were performed using validated QuantiTect primer assays (Qiagen). B2M levels were used as an endogenous control for normalization ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Biochemistry 2021Quote: ... GAPDH transcripts were detected by RT2 qPCR Primer Assay (Qiagen, Cat# 330001 PPQ00249A) and the qPCRBIO SyGreen Mix Hi-ROX kit (PCRBIOSYSTEMS) ...
-
bioRxiv - Cell Biology 2021Quote: ... End-point PCR assays were performed with AllTaq Master Mix (Qiagen, Hilden, Germany), following manufacturer’s recommendations ...
-
bioRxiv - Pathology 2022Quote: ... The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo, Netherlands), and as a normalization gene we used (GAPDH or beta-actin) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA concentration was measured by the Qubit RNA BA assay (Qiagen [32852]). Information on samples from patients use in this study is included in Table 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or GAPDH (catalog no. QT00273322) as an endogenous control (Quantitect Primer Assay, Qiagen). Data analysis was performed with the QuantStudio 6 and 7 Flex Real-Time PCR System Software v1.0 (Applied Biosystems ...
-
bioRxiv - Biochemistry 2022Quote: ... GAPDH transcripts were detected by RT2 qPCR Primer Assay (Qiagen, Cat# 330001 PPQ00249A) and the qPCRBIO SyGreen Mix Hi-ROX kit (PCRBIOSYSTEMS) ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: ... defined by a positive QuantiFERON-TB Gold In-Tube (QFT+) assay (Qiagen, Germany), and 25 HIV-negative adults with TB disease (TB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and qPCR was performed using gene specific QuantiTect Primer Assay primers from Qiagen. Relative expression levels were normalized to gapdh expression according to the formula <2^− (Ct gene of interest − Ct gapdh ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR and sequencing primers were designed by Pyromark Assay Design Software 2.0 (Qiagen) and available upon request ...
-
bioRxiv - Microbiology 2020Quote: ... who tested positive on QuantiFERON-TB Gold in tube assay (Qiagen, Hilden, Germany). All study participants were screened for T2D based on HbA1c ≥ 6.5% and random plasma glucose ≥ 200 mg/dL or a previous history of T2D ...