Labshake search
Citations for Qiagen :
151 - 200 of 951 citations for Small ribosomal subunit protein uS12 RPS23 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... A small portion of the RNA was then reverse transcribed into cDNA using the miScript II RT kit (Qiagen 218160) followed by qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Approximately 1 μg of small RNAs in 8.5 μl were incubated with 2 μl of QIAseq FastSelect –rRNA Yeast Kit (Qiagen, #334215) at 75°C ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA copy number in a small aliquot of each sample was measured on a QIAcuity digital PCR (dPCR) system (Qiagen) using forward primer ACGTGGTGTTTATTACCCTGACA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA of each sample was extracted from small pieces of tail using a QIAGEN DNA Extraction Kit (Qiagen, USA). The quality and integrity of extracted DNA were assessed with the A260/A280 ratio using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... freshly collected or RNAlater (ThermoFisher Scientific)-preserved sections of the distal small intestine were manually homogenized using a pestle tissue grinder assembly and RNA was extracted using a RNeasy minikit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... liver tissue was minced to small slices on a clean and cold surface and finally homogenized with the TissueRuptor II device (Qiagen) making use of its maximal settings ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing long DNA fragments were separated on a magnet and the supernatant containing only small DNA fragments below roughly 800 bp were cleaned up using MinElute PCR purification columns (Qiagen). All libraries were amplified for 12 cycles in total ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Bacterial DNA was isolated from fecal and small intestine luminal content samples via DNeasy PowerSoil Pro Kit (Qiagen, Germantown, MD). Isolated samples were then submitted to the Penn CHOP Microbiome Core for all subsequent steps ...
-
bioRxiv - Bioengineering 2024Quote: miRNA-enriched total RNA (100 ng) was used for small RNA library preparation with QIAseq® miRNA Library Kit (QIAGEN) as instructed ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic DNA of clones showing depletion of spartin protein by immunoblot analysis with the spartin antibody were extracted (DNeasy Blood and Tissue Kit, Qiagen), and the genomic DNA sequence surrounding the target exon of spartin was amplified by PCR (sense ...
-
bioRxiv - Microbiology 2023Quote: ... and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000, Qiagen) as primary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... approximately half of the infected tissue was cut into small pieces and DNA was extracted using a BioSprint 15 instrument and BioSprint 15 DNA plant kit (Qiagen, Australia) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Systems Biology 2020Quote: Total RNA including small RNAs was extracted four hours after electroporation using the RNeasy Plus Mini Kit (QIAGEN GmbH, Hilden, Germany) and the generated samples were sequenced using an Illumina HiSeq-2500 ...
-
bioRxiv - Cell Biology 2021Quote: ... A small portion of the polyp was used for genomic DNA isolation using a DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany), and the remaining portion was immediately fixed in formalin and embedded in paraffin ...
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... Tissue was disrupted by adding two small stainless beads bearings and agitating with a tissue lyser (tissuelyser II, Qiagen, Hilden, Germany) for 10 min at 20 rev/s ...
-
bioRxiv - Physiology 2023Quote: Small RNA-enriched total RNA samples were isolated from P0-HUVECs and placentas using the RNeasy Mini Kit (Qiagen, Valencia, CA). The concentration and quality of each RNA sample were assessed using a NanoDrop™ND-1000 spectrophotometer (NanoDrop Technologies ...
-
bioRxiv - Cell Biology 2024Quote: The expression of each candidate gene was suppressed by two different small interfering RNAs (siRNAs) per target gene (QIAGEN, 20 μM); the sequences are shown in Supplementary Table 12 ...
-
bioRxiv - Microbiology 2022Quote: ... FITC-negative and non-sorted fractions immediately after cell sorting using the QIAmp DNA Microbiome kit (Qiagen) and a FastPrep-24 Classic homogenizer (MP Biomedicals ...
-
bioRxiv - Genetics 2021Quote: ... followed by protein precipitation with the Protein Precipitation Solution (Qiagen) for 10 min at -20 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... For the UCP4 antibody protein samples were extracted from the paraformaldehyde fixed tissue using the Qproteome FFPE Tissue Kit (Qiagen, Germany). The tissue blocks analyzed here were taken from the anterior cingulate and occipital cortex (as described above ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Neuroscience 2021Quote: ... The DNA was extracted from a small portion of the sample (∼25 mg) using the Qiagen DNeasy kit (Qiagen, German-town, MD). The mitochondrial COXI genes were amplified using Folmer’s universal COXI primers LCO1490 (5’-GGT CAA CAA ATC ATA AAG ATA TTG G ...
-
bioRxiv - Bioengineering 2024Quote: ... the extraction of total nucleic acid from transfected MOLT-4 cells (small scale, as described) was performed using a DNeasy Blood and Tissue Kit (QIAgen catalog # 69504) which includes direct lysis with proteinase K treatment ...
-
bioRxiv - Genetics 2021Quote: Total RNA including small RNA species was isolated from cells and entorhinal cortex samples with miRNAeasy mini Kit (QIAGEN, Redwood City, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... we isolated and purified total DNA from native and decellularized small intestine using a DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid library pool was isolated from overnight bacteria culture using QIAGEN HiSpeed Plasmid Midi (small pooled library) of maxi (TSS tiling library) kits (QIAGEN, 12643 and 12662). Lentivirus was produced from cloned plasmid pools in 293FT cells as described above ...
-
bioRxiv - Bioengineering 2021Quote: ... Protein extraction was conducted using a Qproteome Bacterial Protein Prep Kit (Qiagen)‡ ...
-
bioRxiv - Cancer Biology 2022Quote: ... and protein isolation with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen).
-
bioRxiv - Cancer Biology 2023Quote: ... Protein-protein interaction networks were built using Ingenuity Pathway Analysis (IPA) (Qiagen).
-
bioRxiv - Immunology 2024Quote: Total protein extracted from BMDM using the AllPrep RNA/Protein kit (Qiagen) was analyzed with the Osteopontin ELISA kit (Abcam ...
-
bioRxiv - Genetics 2021Quote: ... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein were extracted using the AllPrep DNA/RNA/Protein kit (Qiagen, #47054). Sample concentrations were measured with Qubit high sensitivity dsDNA and RNA platform ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Neuroscience 2020Quote: ... Total protein was extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen #80004) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total protein was purified by the AllPrep DNA/RNA/Protein Mini Kit (Qiagen: # 80004). Corresponding protein expression levels in the cells of different groups were detected by western blot using the following antibodies ...
-
bioRxiv - Cell Biology 2023Quote: Cells were harvested for total protein using a Qproteome Mammalian Protein Prep Kit (Qiagen). Total protein was quantified using a PierceTM BCA Protein Assay Kit (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein Precipitation Solution (Qiagen #158910), DNA Hydration Solution (Qiagen #158914 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 333µl Protein Precipitation Solution (Qiagen) was added and samples were vortexed vigorously for 20 seconds at high speed ...
-
bioRxiv - Biochemistry 2024Quote: ... and Protein Complex suites (Qiagen). The sitting-drop vapor diffusion method was employed ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein was extracted 48 hours post transfection with All Prep RNA/Protein Kit (Qiagen, USA). Protein concentrations were determined by Lowry assay (Bio-Rad ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... protein extraction was performed using the Allprep RNA/Protein Kit (80404 Qiagen Inc., Hilden, Germany). Proteins (10–20 µg ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was isolated from powdered tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). Protein pellets were lysed in HES-SDS buffer (20 mM HEPES [pH 7.4] ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...