Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for SEAP ASSAY KIT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... A2 and B Wolbachia using PyroMark Assay Design 2.0 (Qiagen, USA). A complete list of primers sequences could be found in Table S3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using SYBR Green QuantiTect Primer Assay (Qiagen) according to manufacturer’s instructions in a 7900HT Fast-Real Time PCR System Instrument (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primers (IDT) were designed using the PyroMark Assay Design software (Qiagen)
-
bioRxiv - Cancer Biology 2020Quote: ... The ChIP primers were purchased from Qiagen (EpiTect ChIP PCR assay) and used for qPCR analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the appropriate bespoke designed miScript Primer Assays (Qiagen, Crawley, UK). Real-time PCR was undertaken using a LightCycler® 96 system (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... AT2R qRT-PCR was performed using RT2 qPCR Primer Assay (Qiagen). AT2R ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers were designed with the PyroMark Assay Design 2.0 software (Qiagen), based on the Ensembl GRCh37 assembly (See Supplementary Table 10) ...
-
bioRxiv - Cell Biology 2023Quote: ... All primers were purchased from miScript Primer Assays (Qiagen, Valencia, CA) and GAPDH mRNA expression of each sample was used as normalization.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Genomic DNA was quantified using Qubit DNA Broad Range assay (Qiagen) and quality-checked by agarose gel electrophoresis before adjusting concentration to 150 ng/µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH was used as a control (Hs_Gapdh_3_SG QuantiTect Primer Assay, Qiagen). Each sample was tested in three technical replicates.
-
bioRxiv - Neuroscience 2024Quote: ... miRCURY LNA assays for qPCR of miRNA were purchased from Qiagen, and TaqMan probes were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The individual miRNA assays used in this study were purchased from Qiagen and used with the miRCURY LNA miRNA PCR Starter Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... validated assay to target hsa-MIR-941 (Qiagen product# 339306, catalogue# YP00204574). Each 10µl reaction was made up of the following ...
-
bioRxiv - Neuroscience 2020Quote: ... with 1 µL cDNA using the following oligonucleotides (QuantiTect Primer Assays, Qiagen): Gli1 (Gli1 ...
-
bioRxiv - Immunology 2022Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Neuroscience 2020Quote: ... Mag and Mbp were designed using PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Figure 3 ...
-
bioRxiv - Developmental Biology 2019Quote: ... miRCURY LNA™ miRNA PCR Assays were designed and synthesized by Qiagen for miR-92a-3p as well as miR-19d-3p (miRBase accession ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pyrosequencing primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen). 500ng of genomic DNA was subjected to bisulfite conversion using the EpiTect Bisulfite Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Cancer Biology 2022Quote: ... SMNDC1 primers (Hs_SMNDC1_1_SG QuantiTect Primer Assay QT00014035) were from Qiagen (Hilden, Germany). PCR was performed with Hot Start Taq Polymerase (M0495S ...
-
bioRxiv - Microbiology 2023Quote: ... QuantiTect Primer assays [ACTB (QT00095431) and CDKN1A (QT00062090)] we purchased from Qiagen. ACTB was used for normalization ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins used for inhibition assays were purified using Ni-NTA resin (Qiagen) followed by size exclusion column chromatography (ÄKTA pure ...
-
bioRxiv - Bioengineering 2023Quote: ... and primers from miRCURY LNA miRNA PCR Assays (Catalog No. 339306, Qiagen) for hsa-miR-21-5p (GeneGlobe ID YP00204230) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Mm_miR-29c were the miScript primer assays pre-designed by Qiagen. The mature microRNA sequences were 5’UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a ...
-
bioRxiv - Cancer Biology 2024Quote: ... For two-way qPCR (analysis of MAPK11; Hs_MAPK11_1_SG QuantiTect Primer Assay, Qiagen); cDNA was first synthesised with High Capacity cDNA Reverse Transcription Kit (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Neuroscience 2022Quote: Primers used for expression studies were purchased from Qiagen (QuantiTect Assays, Hilden. Germany): Ccl2 (QT00167832) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR and sequencing primers were designed using the PyroMark Assay Design software (Qiagen). All successfully amplified PCR products were analysed on a PyroMark Q24 (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: All assays were performed on a real-time PCR (Rotor Gene Q, Qiagen). PCR reactions were set-up using the complementary QIAgility robotic pipettor (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... and β2-microglobulin (B2M) mRNAs were performed using validated QuantiTect primer assays (Qiagen). B2M levels were used as an endogenous control for normalization ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Biochemistry 2021Quote: ... GAPDH transcripts were detected by RT2 qPCR Primer Assay (Qiagen, Cat# 330001 PPQ00249A) and the qPCRBIO SyGreen Mix Hi-ROX kit (PCRBIOSYSTEMS) ...
-
bioRxiv - Cell Biology 2021Quote: ... End-point PCR assays were performed with AllTaq Master Mix (Qiagen, Hilden, Germany), following manufacturer’s recommendations ...
-
bioRxiv - Pathology 2022Quote: ... The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo, Netherlands), and as a normalization gene we used (GAPDH or beta-actin) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA concentration was measured by the Qubit RNA BA assay (Qiagen [32852]). Information on samples from patients use in this study is included in Table 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or GAPDH (catalog no. QT00273322) as an endogenous control (Quantitect Primer Assay, Qiagen). Data analysis was performed with the QuantStudio 6 and 7 Flex Real-Time PCR System Software v1.0 (Applied Biosystems ...
-
bioRxiv - Biochemistry 2022Quote: ... GAPDH transcripts were detected by RT2 qPCR Primer Assay (Qiagen, Cat# 330001 PPQ00249A) and the qPCRBIO SyGreen Mix Hi-ROX kit (PCRBIOSYSTEMS) ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: ... defined by a positive QuantiFERON-TB Gold In-Tube (QFT+) assay (Qiagen, Germany), and 25 HIV-negative adults with TB disease (TB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and qPCR was performed using gene specific QuantiTect Primer Assay primers from Qiagen. Relative expression levels were normalized to gapdh expression according to the formula <2^− (Ct gene of interest − Ct gapdh ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR and sequencing primers were designed by Pyromark Assay Design Software 2.0 (Qiagen) and available upon request ...
-
bioRxiv - Microbiology 2020Quote: ... who tested positive on QuantiFERON-TB Gold in tube assay (Qiagen, Hilden, Germany). All study participants were screened for T2D based on HbA1c ≥ 6.5% and random plasma glucose ≥ 200 mg/dL or a previous history of T2D ...
-
bioRxiv - Biochemistry 2021Quote: Assay mixes consisted of 25 nM ALEXA488-conjugated penta-His antibody (Qiagen # 35310), 50 μM DTT ...
-
bioRxiv - Cancer Biology 2020Quote: ... and internal control EIF3D and RPL13A specific primers (RT2 qPCR Primer Assays -Qiagen) and RT² SYBR® Green qPCR master mix using the recommended protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primer design was carried out using PyroMark Assay Design software (version 2.0, Qiagen). Pyrosequencing of biotinylated PCR products was performed using PyroMark Q48 Advanced CpG reagents (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primers used against DDIT3 (CHOP) were commercially available QuantiTect primer assays (Qiagen, UK). Please refer to table S2 and S3 in the supplementary material for the sequences of other primers used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The transcript levels of NOTCH3 were measured using QuantiTect primer assay (QT00003374, Qiagen), the sequences of the other targets are provided in Table 2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Gene expression levels were analyzed using predesigned QuantiTect primer assays (Hs_GAPDH_1_SG: QT00079247 Qiagen, Hs_FPR1_1_SG ...
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... An RNA extraction kit (RNeasy extraction Kit, Qiagen) was used to purify RNA ...