Labshake search
Citations for Qiagen :
151 - 200 of 1262 citations for Recombinant Human Glypican 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant containing His-eIF4A1 or His-eIF4A2 was incubated with a 1.5 ml bed volume of Ni-NTA Superflow (Qiagen, 30430) or a 0.75 ml bed volume of Ni-NTA agarose (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... coli strains expressing (His)6-Clr4 and (His)6-Swi6 and allowed to bind at 4°C overnight to Ni-NTA resin (Qiagen; binding capacity 5-10mg protein/ml resin) ...
-
bioRxiv - Molecular Biology 2022Quote: Drosophila S2 cells were transiently transfected with pAc-brm-FLAG-6xHIS in combination with either pAc-clk-V5-HIS or pAc-V5-HIS empty plasmid using Effectene (Qiagen). For cycloheximide experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transiently transfected with pAc-brm-FLAG-6xHIS in combination with pAc-clk-V5-HIS or pAc-V5-HIS empty plasmid using Effectene (Qiagen). Cells were harvested 48 hours after transfection for processing ...
-
bioRxiv - Biophysics 2023Quote: ... Cleaved PCNA was separated from His-SUMO and uncleaved His-SUMO-PCNA by incubating the protein solution with 5 ml Ni-NTA suspension (Qiagen) resuspended in solution D on a tilting table for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Penta-His Antibody (Qiagen, 34660, IB: 1:1000) and Y188 to APP C-terminus (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... conjugated with anti-penta-his biotin antibody (Qiagen) for 1 and half hours at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... were inserted Bam HI site of pET30a (Qiagen) to produce pET30a-YFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies included: anti-Penta-His (QIAGEN, #34650), anti-FLAG M2 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a Penta His HRP conjugate was used (Qiagen). A Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Bioengineering 2023Quote: ... before his-tag purification with Ni-NTA (QIAGEN) and wash and elution buffers of the same composition as the solubilization buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 µl Hi-Perfect transfection reagent (Qiagen, 301707), and 1 µl of the desired (20 µM ...
-
bioRxiv - Neuroscience 2024Quote: ... 7.5 µl Hi-Perfect transfection reagent (Qiagen, 301707), 1.25 µl siRNA stock (20 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µl Hi-PerFect Transfection Reagent (Qiagen; #301705) and 60 µl of siRNA mixture (1 µM ...
-
bioRxiv - Biophysics 2024Quote: ... or anti-His6X (His HRP conjugate by Qiagen) antibodies at a 1:1,000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... Memorial Sloan Kettering Cancer Center) at a dilution of 1:5,000) and His (mouse anti-penta-His antibody (Qiagen, cat. #34660) at a dilution of 1:10,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 40% of the protein material of each fraction was analyzed by Western blot using an anti-his antibody (Penta-His antibody, Qiagen #34660). Detection was performed with a secondary antibody conjugated with horseradish peroxidase (Anti-Mouse IgG Peroxidase antibody ...
-
bioRxiv - Microbiology 2022Quote: ... His6-tagged protein was affinity purified using NiNTA resin (Qiagen), which was washed with binding buffer ...
-
bioRxiv - Microbiology 2020Quote: ... His6-tagged protein was affinity purified using NiNTA resin (Qiagen), which was washed with binding buffer ...
-
bioRxiv - Immunology 2020Quote: ... and His6-tagged protein was captured on NiNTA agarose (Qiagen). Following extensive washes with core buffer supplemented with 20 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... for GST-tagged protein or Ni-NTA Agarose beads (QIAGEN) for His-tagged protein ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for GST-tagged protein or on Nickel beads column (Qiagen) for 6XHIS-tagged protein ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked with 5% milk in PBST (Phosphate buffer saline, 0.05% Tween 20) and incubated with monoclonal mouse anti-His antibody (Penta His, Qiagen, dilution 1:1000) according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Genetics 2019Quote: ... or anti-tetra His (0.1 μg/ml Qiagen 34670) were used as primary antibodies ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His is a peroxidase-conjugated antibody (Qiagen). The membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... PABPC1-His was bound to Ni-NTA resin (Qiagen), washed by 1x PBS (10 mM imidazole added ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...
-
bioRxiv - Microbiology 2020Quote: ... The anti-His antibody conjugated to horseradish peroxidase (Qiagen) was used at a dilution of 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1,000 dilution of α-His-HRP antiserum (Qiagen), or 1:1,000 dilution of α-OmpA antiserum (Antibody Research Corporation ...
-
bioRxiv - Plant Biology 2022Quote: ... and NoFa-ICL was the Penta-His antibody (Qiagen) at 1:4000 in TBST ...
-
bioRxiv - Immunology 2022Quote: ... then incubated with the primary antibody anti-His (Qiagen) at a concentration of 1:2500 in a solution of 3% non-fat milk in TBS-T overnight at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Anti-Penta-His antibody was purchased from Qiagen (Germany).
-
bioRxiv - Biophysics 2024Quote: ... were functionalized with biotinylated α-penta-His antibody (Qiagen, Hilden Germany or R&D Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant plasmids were then isolated (MiniPrep, Qiagen) and sequenced (DNA Sequencing Facility ...
-
bioRxiv - Biophysics 2021Quote: ... His10-tagged SecYEG was isolated using Ni2+-NTA agarose resin (Qiagen). Once bound to Ni2+-NTA beads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the tagged DNA was cleaned with the Min Elute kit (Qiagen) and processed to a sequencing library ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2019Quote: ... A 10 nM solution of biotinylated penta-His antibody (Qiagen) was incubated for 10 min on the neutravidin-coated surface and excess unbound antibody removed (22 ...
-
bioRxiv - Bioengineering 2020Quote: ... Anti-Penta-His Alexa Fluor 488 conjugate was from Qiagen.
-
bioRxiv - Microbiology 2022Quote: ... and His-PutA was purified with Ni-column chromatography (Qiagen). The purified His-PutA protein (50 μg ...
-
bioRxiv - Biochemistry 2021Quote: Penta-His HRP conjugate was purchased from QIAGEN (Hilden, Germany). Anti-BepA (Narita et al. ...
-
bioRxiv - Immunology 2022Quote: ... and incubated with Penta-His-biotin conjugate 1:5000 (Qiagen) overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used Penta-His mouse monoclonal antibody (Qiagen, Qiagen #34660) at a 1:2000 dilution in 5% BSA in PBS-T buffer for 1 h ...