Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for Mouse Fibroblast Growth Factor 15 FGF15 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse tissue RNA was extracted using the RNeasy Mini Kit (Qiagen, 74106) following the manufacture’s instruction ...
-
bioRxiv - Genomics 2020Quote: ... except that the KRABINER sequence was amplified from cDNA extracted from Myotis velifer embryonic fibroblasts (Qiagen RNEasy Mini Kit #74104 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1.0–3.0 μl (5.0–15 pmol) of primers and 7.5–15 μl of 2x Multiplex PCR Plus Master mix (QIAGEN). The PCR protocol consisted of an initial DNA polymerase (HotStar Taq ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA from 15 post-operative endopthalmitis isolates was extracted using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD) from 1mL bacterial cultures grown in Brain Heart Infusion media ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from MSCs cultured for 3 or 15 days under different experimental conditions using RNeasy Micro Kit (Qiagen). RNA quantity and integrity was measured with a NanoDrop 1000 (ThermoScientific) ...
-
bioRxiv - Genetics 2019Quote: ... or 0.1% DMSO control (n = 15) in the absence of H2O2 for 24 hours and then processed for RNA isolation with the RNeasy kit (Qiagen). Reverse transcription (RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... In vitro transcribed mRNAs were DNAse-treated using TURBO-DNAse for 15 min at 37°C and purified using the RNeasy Mini Kit (Qiagen) and quantifed using Qubit™ RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... Cultures were spun at 3500 x g for 15 min and RNA was extracted from the bacterial pellet with QIAzol lysis reagent and the miRNeasy Mini Kit (Qiagen). rRNA was removed with the Bacterial RiboMinus Transcriptome Isolation Kit (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... The cells were collected via centrifugation at 2500 ×g for 15 min and used for DNA purification using the DNeasy Blood & Tissue Kit (Qiagen), following the optional protocol for gram-negative bacteria provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA expressing cells were isolated by fluorescence activated cell sorting at passage doubling 1 and 15 followed by genomic DNA isolation with Gentra Puregene cell kit (Qiagen). Sequencing libraries were prepared by subjecting 18 μg (1.2 μg x 15 reactions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was purified from a homogenate of a whole single adult female cricket prepared by 15 min beating with a lead bead using the MagAttract HMW DNA Kit (Qiagen) according to manufacturer specifications ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total genomic DNA was extracted from ethanol-preserved fin tissues using the BioSprint 15 kit for tissue and blood (Qiagen). Sequences of the mitochondrial gene ...
-
bioRxiv - Microbiology 2021Quote: ... and 15-30 μg of DNA was extracted from ethanol-fixed fish tissues using a DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s guidelines.
-
bioRxiv - Cancer Biology 2022Quote: A ready-to-transduce transcription factor-responsive lentiviral reporter system (CCS-1022L, QIAGEN) was used to generate a stable cell line ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 15 min of DNase I (Qiagen) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted from mouse liver samples using RNeasy Mini Kit (Qiagen), DNase treated and 1 μg total RNA was processed for mRNA sequencing ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA of mouse islets was extracted using RNeasy Plus Mini Kit (Qiagen). Other tissues including mouse liver ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the RNA from mouse liver was isolated using RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Total RNA was extracted from mouse pituitaries using an RNeasy mini kit (Qiagen) and 250 ng converted to cDNA using Revertra Ace (TOYOBO ...
-
bioRxiv - Neuroscience 2020Quote: ... or RNeasy Mini Kit (synaptosome and cytosolic fraction from homogenized mouse forebrain; Qiagen). For RT-PCR ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse plasma was isolated using Qiamp RNA-mini isolation kit (Qiagen) and RNA from tissues isolated using the RNeasy mini isolation kit (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from mouse neural retina using RNeasy mini kit (QIAGEN). Total RNA was reverse transcribed in the presence of PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time ...
-
bioRxiv - Physiology 2023Quote: ... total RNA was prepared from mouse liver using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: We extracted RNA from fresh mouse using an AllPrep DNA/RNA kit (Qiagen). We placed 5-10 mg of tissue into 350 μL RLT Plus Buffer in a 2 mL tube containing a 5mm stainless steel bead and homogenized with a TissueLyzer for two 2 min rounds at 30 Hz ...
-
bioRxiv - Immunology 2023Quote: ... Total mRNA was extracted from mouse tumors using the RNeasy Mini Kit (QIAGEN) and subsequently tested for concentration and integrity via NanoDrop 2000c (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... total mRNA was isolated from mouse T cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Developmental Biology 2020Quote: DNA was extracted by standard protocols from fetal fibroblasts and FFPE (Formalin-fixed paraffin-embedded) tissue (Qiagen). PCR-amplifications of exons and intron-exon boundaries of TTC30A (ENST00000355689.6 ...
-
bioRxiv - Evolutionary Biology 2020Quote: We extracted genomic DNA from pools of 60 whole adult males and 15 whole virgin adult females using DNeasy Blood and Tissue kit (Qiagen, CA) and Promega DNA Clean and Prep Kit (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bacterial cells were pelleted by centrifugation at 6,000 RCF at 4°C for 15 minutes and plasmid DNA was extracted using a Qiagen Plasmid Plus Midi Kit (Qiagen #12943). To estimate the total number of unique barcodes present in the plasmid pool ...
-
bioRxiv - Microbiology 2021Quote: ... Suspended fecal samples and swab samples were centrifuged at 4,000 x g for 15 min and viral RNA was extracted from each supernatant using the QIAamp Viral RNA Mini Kit (Qiagen, USA). Conventional RT-PCR was performed using the Invitrogen™ SuperScript™ IV First-Strand Synthesis System (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-qPCR were performed using primers previously described by Dias de Melo et al [15] using QuantiNova SYBR® Green RT-PCR Kit (Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The samples were then transferred to a 15 ml tube and processed with a Qiagen Midi Prep Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The complete set of 15 loci were amplified in four separate 15 μL multiplex-PCR reactions containing 7.5 μL of 2X Master Mix (Type-It Microsatellite PCR kit, Qiagen, Venlo, Netherlands), 0.015-0.15 μL of unlabeled forward primer with tail (10 μM) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 µg of gDNA was eluted in 15 µl of elution buffer from the EpiTect Fast DNA Bisulfite kit (Qiagen, 59824). A 20 µl PCR reaction was composed of 0.5 µl of bisulfite-converted gDNA input ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA extractions were performed on cell pellets from 15 mL of these back-diluted cultures using QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... Isolated genomic DNA (500 ng) of E8.5 mouse embryos (QIAamp DNA mini kit, 51304 or AllPrep DNA/RNA Micro Kit, Qiagen, 82084) and spike-in lambda DNA (1.25 ng ...
-
bioRxiv - Immunology 2023Quote: ... Samples were enriched for CD45+ cells using an EasySep Mouse TIL (CD45) Positive Selection kit (STEMCELL) and RNA was extracted with an RNeasy Plus Mini Kit (Qiagen). TdLN samples were processed as previously described ...
-
bioRxiv - Immunology 2023Quote: ... Samples were again enriched for CD45+ cells using an EasySep Mouse CD45 Positive Selection kit (STEMCELL) and RNA was extracted with an RNeasy Plus Mini Kit (Qiagen). RNA was stored at −80°C until further processing.
-
bioRxiv - Developmental Biology 2023Quote: ... and eluted in 15 μl Buffer EB (QIAGEN). 1 ng of pre-amplified cDNA was used for the tagmentation reaction (55C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µl Hi-PerFect Transfection Reagent (Qiagen; #301705) and 60 µl of siRNA mixture (1 µM ...
-
bioRxiv - Molecular Biology 2020Quote: Purified RNA was isolated from mouse skin using the RNeasy Plus Mini Kit (Qiagen) after pulverization of the frozen skin tissue and homogenization with the QIAshredder system (Qiagen) ...