Labshake search
Citations for Qiagen :
151 - 200 of 1207 citations for IL 5 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... using commercially available primers for human FAAH (CpG Island 100530) (EPHS100530-1A, Qiagen). Methylation-sensitive (EPHS115450-1A ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was extracted from human thyroid tissues using miRNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and as described [26] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or primary human cells were extracted using the Qiagen RNeasy Micro Kit (Qiagen). cDNA was produced using the SuperScript IV VILO cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... Human rRNA depletion was performed using the QIASeq FastSelect kit (Qiagen, Hilden, Germany). RNA sequencing library preparation used NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s recommendations (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: DNA from human stool samples was extracted with DNeasy PowerSoil Pro kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total RNA for human TSCs was extracted using RNeasy Micro kit (Qiagen, 74004) with on-column DNase digestion ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a 96 well RT2 profiler PCR array human apoptosis kit (Qiagen, Germantown, MD) containing 84 apoptotic genes was used according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Immunology 2019Quote: ... total RNA (2.5-5 μg) was extracted from BM mononuclear cells obtained by Ficoll-Paque gradient centrifugation using the miRNeasy kit (Qiagen) and depleted of ribosomal-RNA (Ribo-Zero™ rRNA Removal Kit ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCGTCATCAGGATTGGCAA and probe 5’-TGGGTGTCTGCTTTGGAACA were used in a one-step qRT-PCR reaction with either Quantifast reagents (Qiagen) for tissue RNA or LightCycler 480 RNA Master Hydrolysis Probes (Roche ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total DNA was extracted from males (N = 5) and females (N = 5) of each genotype using the DNeasy Blood & Tissue kit following manufacturer protocol (Qiagen). Illumina libraries were prepared using the Nextera DNA Flex Library Preparation Kit (Illumina) ...
-
bioRxiv - Immunology 2024Quote: ... and brain) homogenates collected from mice at 5 dpi and 5 dpc were generated using the Tissue Lyzer II (Qiagen). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... An 80 μL sample of the supernatant was transferred to a new tube and incubated with 5 μL of 5 mg/mL Proteinase K (QIAGEN) for 1 h at 60°C ...
-
bioRxiv - Neuroscience 2024Quote: Isolated dorsal striatal microglia (n = 5-7 per condition) were centrifuged for 5 min at 600xg and resuspended in RLT plus buffer (Qiagen) for extraction and purification of total RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reactions were incubated for 15 min at 60°C and then terminated by adding 1 μL 5 M NaOH to degrade RNA and heating at 95 °C for 5 min followed by neutralization with 1 μL 5 M HCl and one round of MinElute column clean-up (Qiagen). The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA from dorsal mouse skin was isolated from 5 control and 5 transgenic GRK2 eKO animals with RNAEasy Mini kit (#74104, Qiagen), following manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 5-10 μg RNA was DNAse treated (Qiagen) and rRNA was depleted (MICROBExpress ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 mm diameter stainless steel beads (QIAGEN) were added to each sample pool ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... and 5-mm stainless-steel beads (Qiagen #69989) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Proteinase K (20 mg/mL, Qiagen) and 100 µl 10% SDS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 5-mm stainless steel beads (Qiagen #69989). RNA purification was performed using the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Physiology 2020Quote: ... with 5 mm beads in RLT buffer (Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5 mm diameter stainless steel beads (Qiagen) and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with 5-mm stainless steel beads (Qiagen #69989). RNA extraction was carried out with the NucleoSpin RNA kit (Macherey-Nagel ...
-
A conserved RNA switch for acetylcholine receptor clustering at neuromuscular junctions in chordatesbioRxiv - Developmental Biology 2024Quote: ... 5 U/μL HotStarTaq Plus DNA polymerase (Qiagen) (0.4 μL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cancer Biology 2022Quote: MIEV-or PKCα-KR-transduced HSPCs were co-cultured on OP9 cells in the presence of IL-7 for 17-23 days (late co-culture) and total RNA was isolated using an RNeasy kit (Qiagen, Manchester, UK) from five independent co-cultures ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genetics 2021Quote: Human genomic DNA (gDNA) was extracted using the QIAamp DNA Mini Kit (QIAGEN, Germany) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... pallidum and human RNase P gene (RNP) using a Rotor-Gene 6000 instrument (Qiagen) as previously described with modifications (11 ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...