Labshake search
Citations for Qiagen :
151 - 200 of 1257 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... LNA™ PCR primer set (Qiagen). PCR amplification and detection were performed with the Applied Biosystems StepOnePlus Real-Time detector ...
-
bioRxiv - Immunology 2023Quote: ... Pre-synthesized QuantiTect primers from Qiagen were used for il12b ...
-
bioRxiv - Genetics 2024Quote: ... Dm_miR-8_1 miScript Primer assay (QIAGEN), and Dm_miR-14_1 miScript Primer assay (QIAGEN ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The primers were purchased from Qiagen (Catalogue number ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse ATP7A: Primers purchased from Qiagen with Cat # Mm_Atp7a_1_SG QuantiTect Primer Assay (QT00152677 ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers with HotStarTaq Master Mix Kit (Qiagen). The following PCR condition was used ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... All the primers (forward, reverse and sequencing primers) were designed with the PyroMark Assay Design software (Version 2.0.1.15, Qiagen) using the assay type "Methylation Analysis" (CpG ...
-
bioRxiv - Biophysics 2024Quote: ... and bioinformatically validated specific primers (Gapdh, QT00199388; Rpl13a, QT00267197; Ifnb1, QT00249662; Trex1, QT00288967; QuantiTect Primer Assay, Qiagen). The final volume was 20 µL and the cycling conditions were a holding stage of 95°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR reactions were run using a QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotorgene Q ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR reactions were run using the QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotor-Gene Q ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA for Illumina mate-pair sequencing was extracted using the DNeasy Plant Mini Kit (Qiagen) from 8-week-old leaves of ALO seedlings ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA samples were amplified in technical duplicates in presence of gene specific primers (QuantiTect® Primer Assays, Qiagen) and QuantiTect® SYBR Green Master Mix (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Bioengineering 2023Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mir-103 (Qiagen primer Cat. No. YP00204306) was used as reference miRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... using gene specific primers (QuantiTect®, Qiagen) and SyBr Green PCR master mix (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and commercially available miScript primer assays (Qiagen) targeting miR-39 and the 5 top ranked candidate miRNAs ...
-
bioRxiv - Cell Biology 2022Quote: ... Hs_ARHGEF40_1_SG and Hs_STARD8_1_SG QuantiTect Primer Assays (Qiagen) were used to detect the ARHGEF40 and the STARD8 transcripts ...
-
bioRxiv - Neuroscience 2021Quote: ... Validated primer sets were obtained from Qiagen.
-
bioRxiv - Bioengineering 2021Quote: ... QuantiTect primers were all purchased from Qiagen: B2m (QT01149547) ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primers were purchased from Qiagen: miR-663b (MS00037884) ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primers were purchased from Qiagen: SOX2 ...
-
bioRxiv - Immunology 2020Quote: ... β-actin (pre-designed primers from Qiagen); HPRT(Eun et al. ...
-
bioRxiv - Immunology 2021Quote: ... QuantiTect Primer Assays were purchased from Qiagen. Primer information is summarized in table 2.
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Validated QuantiTect primer sets obtained from (Qiagen) for IL-1α (QT00001127) ...
-
bioRxiv - Physiology 2023Quote: ... and oligo-dT primers (Qiagen, cat # 79237). Each 20 µl reaction included ...
-
bioRxiv - Immunology 2022Quote: ... using pre-designed SYBR Green Primers (QIAGEN) specific for Ifit2 (PPM05993A) ...
-
bioRxiv - Microbiology 2023Quote: ... detected by QuantiTect primer assay (QT01658692, Qiagen) and the qPCRBIOSyGreen mix Hi-ROX (PCR Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers targeting miR-451a (QIAGEN, 3624799) and U6 snRNA (v2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... miRCURY LNA miR-155 primer from Qiagen was used for each miRNA reverse transcription reaction ...
-
bioRxiv - Immunology 2024Quote: ... and oligo(dT) primers (Qiagen, Hilden, Germany), and then amplified with a Ssoadvanced SYBR Green master mix (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... and Dm_miR-14_1 miScript Primer assay (QIAGEN) and Thermal Cycler Dice Real Time System (TAKARA) ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR amplification was performed on a Roche light cycler using OneStep qPCR SYBR green kits (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: All qPCR and RT-qPCR-reactions were done using the QuantiTect Multiplex PCR NoROX Kit (Qiagen) or QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... and loaded into the Pig Inflammatory Cytokines & Receptors RT2 ProfilerTM PCR Array (Qiagen, Hilden, Germany). The qPCR reactions were performed using a Qiagen Rotor-Gene Q real-time cycler ...
-
bioRxiv - Microbiology 2020Quote: ... A custom RT2-qPCR array (Qiagen) was designed to detect asthma inflammatory profiles along with the endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Pathology 2020Quote: ... miScript SYBR green qPCR kit (Qiagen) and miScript primer assay (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: Quantitative real-time PCR for stemness and differentiation genes was performed using primers purchased from Qiagen (QuantiTect primer assay). RNA was isolated from cells according to the manufacturer’s instructions using Trizol (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pair-wise sequence alignments were performed using Alignment and trees tool of CLC genomics workbench (Qiagen). The promoter sequences were analyzed for the presence of putative cis-regulatory elements by PlantCARE (Rombauts et al ...
-
bioRxiv - Immunology 2020Quote: 4 matched pairs of Treg and MulTreg were expanded and RNA extracted (RNeasy RNA extraction kit, Qiagen). cDNA was then produced (SMART cDNA synthesis kit ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 replication was quantified via RT-qPCR using the QuantiTect Multiplex RT-qPCR Kit (Qiagen) with a Rotor Gene Q cycler (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was then performed in a 20 μL reaction volume with 2×SYBR Green qPCR mix (Qiagen), 100 nM each of the sense and antisense primers (Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... The himar1 enriched samples were diluted 1:50 and amplified by using a P5 indexing primer (AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC, [i5] barcode sequence) and P7 primer HotStarTaq Master Mix Kit (Qiagen) to add unique barcodes and the necessary P5 and P7 flow cell adaptor sites for Illumina sequencing ...
-
bioRxiv - Immunology 2020Quote: ... the miScript Universal Primer was used alongside miR specific miScript primer assays (miR-206 cat. no. MS00001869 and U6 cat. no. MS00033740; Qiagen).