Labshake search
Citations for Qiagen :
151 - 200 of 662 citations for Chondroitin Sulfate Proteoglycan 4 CSPG4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... we used 4 columns to purify product following the MinElute PCR Purification Kit manual (Qiagen). DNA from each column was eluate using 25 μL EB buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Clarified lysate was then incubated for one hour at 4 °C with Ni-NTA (Qiagen) in batch adsorption format ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Bioengineering 2022Quote: ... 350 µL of NucleoSpin RNA extraction buffer along with 4-5 ceramic beads (Qiagen 13113) were added 14into the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... 30 cycles) and the 170bp band purified on a 4% agarose gel (Qiagen gel purification). Fragments were extended with homology arms (Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... 4 µg of the total RNA was treated with a GeneRead rRNA Depletion kit (Qiagen) and then with an RNeasy MiniElute kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Plant Biology 2022Quote: Total plants RNA were extracted from 4 weeks plants using the RNeasy kit (Qiagen, Germany) and two micrograms of RNA was reverse-transcribed using SuperScript IVTM Reverse Transcriptase according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatant was added to a gravity column containing 4 mL of Ni-NTA (Qiagen). Beads were washed with a high salt buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... to which 4 μL of RNase A (100 mg/mL) was added (Qiagen, Germantown MD). The cell lysate was applied to a DNeasy Mini spin column ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned with the UltraClean 96 PCR Cleanup kit (Qiagen, Cat. #12596-4) and pooled using the same volume for each sample ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluent was then incubated overnight at 4°C with Ni-NTA beads (Qiagen, 36111), which were subsequently collected ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or from whole fecal pellets using a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4). Library preparation and sequencing was performed at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Immunology 2024Quote: ... organ parts collected as described above were homogenized by TissueLyser II (Qiagen, 25Hz, 4 min) and centrifuged to remove debris ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μl of siRNAs were mixed with 37.5 μl of Hiperfect transfection reagent (301707, Qiagen) and enough Optimem Opti-MEM reduced serum medium (31985070 ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal mouse Strep-tag antibodies (#34850, Qiagen), a monoclonal anti-actin antibody (A5441 ...
-
bioRxiv - Biochemistry 2022Quote: ... Penta-His Antibody (Qiagen, 34660, IB: 1:1000) and Y188 to APP C-terminus (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... analysed by western-blotting using Penta·His Antibody (QIAGEN), of wild-type OxlT measured on the same day of experiment ...
-
bioRxiv - Cell Biology 2019Quote: ... conjugated with anti-penta-his biotin antibody (Qiagen) for 1 and half hours at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies included: anti-Penta-His (QIAGEN, #34650), anti-FLAG M2 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated with biotinylated anti-5His antibodies (Qiagen) and stored for up to 6 months with continuous rotation at 4°C in BRB80 (80 mM Pipes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 40% of the protein material of each fraction was analyzed by Western blot using an anti-his antibody (Penta-His antibody, Qiagen #34660). Detection was performed with a secondary antibody conjugated with horseradish peroxidase (Anti-Mouse IgG Peroxidase antibody ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... total RNA was harvested from BMDM 4 hours post-treatment per Qiagen RNA extraction protocol (QIAGEN). RNA was then reverse transcribed to cDNA using iScript Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...