Labshake search
Citations for Qiagen :
151 - 200 of 1600 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... ∼100 ng of total RNA from each cell type was used as input to generate miRNA sequencing libraries using a QIAseq miRNA library kit (Qiagen). Single-end 100 bp reads (1×100 ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was extracted from 14-day-old wild-type and acinus-2 pinin-1 seedlings using RNeasy mini kit (Qiagen) and treated with TURBO DNA-free Kit (Ambion ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified using 96-well PCR array analysis on a PAMM-150ZA plate (Cytokines & Chemokines) and PAMM-016ZA plate (Type I Interferon Response) (both Qiagen). Quantitative real time-PCR (QRT-PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ES2 human clear cell carcinoma cells present (wild type) or absent (siRNA) ARID1A were collected and extracted using an RNeasy Plus Micro Kit (Qiagen). Barcoded TruSeq RNA v2 libraries (Illumina ...
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted from a wild type clone and a mutant using a QIAGEN Plasmid Midi Kit (Qiagen, Tokyo, Japan) and used as standard DNA to determine ratios of mosaicism ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pathway analysis of genes adjacent to identified tissue and cell-type specific methylation blocks was performed using Ingenuity Pathway Analysis (IPA)(42) (Qiagen) and Genomic Regions Enrichment of Annotations Tool (GREAT)(43) ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was extracted from 20 trunks of either E8.5 wild-type or Aldh1a2-/- embryos with the RNeasy Micro Kit (Qiagen #74004). Reverse transcription was performed with the High-Capacity cDNA RT Kit (Thermo Fisher Scientific #4368814) ...
-
bioRxiv - Genomics 2019Quote: ... and two control bulls that were homozygous for the wild type allele was extracted from testis tissues using the RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Molecular Biology 2020Quote: DNA extraction was done from 1 ml of the different sample types using QIAamp DNA mini kit (Qiagen, Hilden, Germany), as per the vendor’s instructions with slight modifications ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from wild-type and ΔTMPRSS2 293T cell lines using the Puregene cell kit according to the manufacturer’s instructions (Qiagen, #158388). Co-transfection of pJC144 (guide 1 ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction from cultured tprAko-SS14 or wild-type strains propagated in 6-well plates following the transformation procedure was performed using the QIAamp mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: E9.5 hindbrain spanning rhombomeres 1-6 were dissected from wild type and mutant embryos (n=3) to obtain total mRNA preparations (miRNeasy Micro Kit, Qiagen). Sequencing libraries were prepared following the SMART-Seq v4 Ultra Low Input RNA (TaKaRa ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from one wild-type control and three patient cell lines using DNeasy Blood and Tissue kit (Qiagen). Specific primers were designed to cover approximately 500 base pairs around the mutations and the regions were PCR-amplified using Qiagen Multiplex PCR kit (Qiagen) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... with tissue homogenization being performed using a rotor stator type tissue homogenizer (ProScientific Bio-Gen PRO200 Homogenizer; Multi-Gen 7XL Generator Probes) in RLT Buffer (Qiagen). RNA quality was assayed using a nanodrop ...
-
bioRxiv - Genetics 2022Quote: Total RNA was isolated from 50 to 100 μl of packed worms from wild type and brd-1(null) using the RNeasy Mini Kit (74104; Qiagen) and QIAshredder (79654 ...
-
bioRxiv - Neuroscience 2022Quote: Brain and spinal cord tissue from Prp-TDP43A315T (Tg) animals and wild type (Wt) littermates were homogenized using a TissueRuptor (Qiagen). 1 mL of TRIzol per 250 mg of tissue was used for homogenization and RNA was isolated as per the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Molecular Biology 2023Quote: ... cf-DNA quantified from various plasma or serum types using either MitoQuicLy or a silica-based membrane column DNA extraction kits (DNeasy, Qiagen). A total of 50 samples were analyzed (5 biofluids ...
-
bioRxiv - Biochemistry 2023Quote: ... A linearized PCR template was generated by digesting a wild-type Hrd1 plasmid with restriction enzyme and purified using a QIAquick PCR purification kit (Qiagen). For each region two separate PCR reactions were set up ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from adult ovaries of transgenic or wild-type zebrafish using the RNeasy Mini kit (QIAGEN, 74134) and reverse-transcribed using SuperScript IV reverse transcriptase (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA from HeLa cells transfected with either wild-type PADI2 (WT) or mutant PADI2 (with L642A, or L642A/W161A, or L642A/W161A/T159A) was extracted using RNeasy (Qiagen) according to the manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pathway analysis of genes adjacent to identified tissue and cell-type specific methylation blocks was performed using Ingenuity Pathway Analysis (IPA) (Qiagen) (90).
-
bioRxiv - Molecular Biology 2024Quote: RNA isolation from leaf tissues of five-week-old non-transformed wild type and overexpressing transgenic lines (two replicates of wild type and two transgenic lines) were isolated as per manufacturer’s instruction (Qiagen, Germany). High quality RNA samples with 200 ng/μL concentration were outsourced for RNA-seq ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was isolated from two-week-old Villersexel wild type and the nog1dis mutant using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...