Labshake search
Citations for Qiagen :
151 - 200 of 3563 citations for 7 AMINO 2 TERT BUTOXYCARBONYL 1 2 3 4 TETRAHYDROISOQUINOLINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Neuroscience 2023Quote: ... the tissue was ground using a tissue lyser (Qiagen, 3 min at 300 s-1) in 200 µL 500 mM Tris pH 9 by adding a metal ball (diameter 5 mm) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Germany) using a metal ball for 2×2 min at 25 s−1 in 600 μl of RLT buffer (Qiagen, Germany) with 1% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2022Quote: ... Organs were homogenized by high-speed shaking in 2 mL microcentrifuge tubes filled with sterile PBS and 5/7 mm stainless steel beads using TissueLyser LT (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: ... ~2×108 cells/replicate in late exponential and ~4×108 cells/replicate in stationary phase were incubated with RNAprotect Bacteria Reagent (Protocol 3, Qiagen, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from 16 placentas (3-4 placentas/fetal sex/group) using an RNAeasy kit (Qiagen, Venlo, The Netherlands). Isolated RNA was stored at −80 °C in nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: ... 5’ and 3’ untranslated regions and open reading frames) for the paralogs were made using the CLC Main workbench 7 (QIAGEN® Aarhus A/S, Aarhus C, Denmark). Sequence alignments were generated for the genomic DNA ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 nucleic acids were isolated from 300 µl viral transport media using the QIAamp Viral RNA Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the supernatant was added to 2 ml of pre-equilibrated Nickel-nitrilotriacetic acid (Ni-NTA) agarose (QIAGEN, Cat. No. 30210) 50% slurry and rotated at 4°C for 2 h ...
-
bioRxiv - Plant Biology 2019Quote: ... Supernatant was applied twice to a column containing a gel bed of 2 ml nickel-nitriloacetic acid agarose (Qiagen, www.quiagen.com) equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble extracts were applied to 2-ml columns of nickel-nitrilotriacetic acid- agarose (Ni-NTA) (QIAGEN catalog no. 30210) that had been equilibrated with lysis buffer without protease inhibitors ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Biochemistry 2023Quote: ... 10 µg⋅ml –1 Leupeptin and 3 mM Benzamidine) with steel beads at 28.5 Hz for 1 min (Qiagen TissueLyser II ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Four 2-mL aliquots of culture were thoroughly mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) and incubated at room temperature for 5 min before centrifugation at 4,000 × g for 12 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated for ~2 h rotating at 4°C with Ni-NTA Resin (Qiagen, 1018244) that had been washed with wash buffer (20mM Tris HCl pH 8.0 ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was extracted from 2 to 4 ml of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... The filtered supernatant was loaded onto 2 gravity columns each with 4 mL Ni-NTA agarose (Qiagen). The resin was pre-equilibrated with the lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: Tissue samples of mice were transferred into 2 ml tubes containing 4 mm stainless steel beads (Qiagen) and 1 ml of ice-cold sterile saline ...
-
bioRxiv - Genetics 2024Quote: ... 2 or 4 days and genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Bisulfite converted DNA libraries were prepared using the Accel-NGS Methyl-Seq DNA library kit (SWIFT BIOSCIENCES) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).