Labshake search
Citations for Qiagen :
151 - 200 of 1933 citations for 6H Pyrano 3 2 g benzothiazole 8CI 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... HMW gDNA was captured by magnetic particles (Qiagen MagAttract Suspension G), and then the magnetic particles with HMW gDNA was washed in wash buffer and eluted in EB Buffer (10 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... A nonmethylated control was prepared using REPLI-g Mini kit (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... Control unmethylated DNA was prepared using a Repli-g kit (QIAGEN). C ...
-
bioRxiv - Neuroscience 2022Quote: ... using Qiagen Genomic-tip 100/G HMW Kit (Qiagen, Hilden, Germany), according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: We extracted DNA using the Qiagen Genomic Tip 20/G (Qiagen) and followed the manufacturer’s protocol “Preparation Gram-negative and some Gram-positive Bacterial Samples” ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the QIAGEN Genomic-tip 20/G standard protocol (Qiagen, UK). All samples were sequenced at the University of Liverpool from Illumina TruSeq Nano libraries with 350bp inserts using 125bp paired-end reads on an Illumina HiSeq2500 platform ...
-
bioRxiv - Microbiology 2019Quote: ... pylori-infected mice using a genomic-tip 20/G kit (Qiagen, catalog no ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was purified using Qiagen Genomic-tip 20/G (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... followed by DNA extraction using Genomic Tip G-500 columns (Qiagen) and cleaning with the PowerClean DNA Clean-Up kit (MoBio Labs) ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... 20 μL REPLI-g sc DNA Polymerase (Qiagen, catalog no. 150345), 30 μL 10 x Eva green (biotium ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... genomic DNA was directly amplified using the Repli-G kit (Qiagen), and then sequenced with Illumina HiSeq from TruSeq gDNA libraries by GenomeQuebec ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.5 g roots using RNeasy Plant Mini Kit (QIAGEN, Canada). Extracted RNA was treated with DNAse (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used a Repli-G whole- genome amplification kit (Qiagen, Inc.) to increase the amount of DNA prior to library preparation ...
-
bioRxiv - Microbiology 2024Quote: Plasmid DNA was amplified using REPLI-g® Midi Kit (QIAGEN), according to the manufactureŕs instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and whole-genome amplified using a REPLI-g Single Cell kit (Qiagen) before sequencing on either Illumina NextSeq500 at the Department of Biochemistry ...
-
bioRxiv - Genomics 2020Quote: ... total gDNA was obtained from tissue using Genomic-tip 100/G (Qiagen) for the spotty (Notolabrus celidotus) ...
-
bioRxiv - Genomics 2019Quote: DNA was isolated using Qiagen Genomic-tip 100/G (Qiagen, Hilden Germany) according to the instructions of the manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... D1 buffer from REPLI-g single cell kit (Qiagen, catalog no. 150343) was added to denature the DNA ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was then extracted using the Genomic-Tip G/500 kit (Qiagen) following the manufacturers protocol for Gram negative bacteria and eluted into 5 mM Tris pH 7.5 0.5 mM EDTA buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... WGA was conducted using the REPLI-g Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... multiple displacement amplification (MDA) reaction mix (REPLI-g Single Cell Kit, QIAGEN) was added to the lysate and incubated at 30 °C for 3 hours ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA was extracted using a ‘Genomic-tip 20/G’ kit (Qiagen) and sequenced with 150 bp paired-end ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified DNA libraries were prepared with the Repli-G mini kit (Qiagen) and LSK114 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA extracts were further purified on the GenomicTip G/20 column (Qiagen) by the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... the supernatant was loaded on equilibrated Genomic-tip 20/G column (QIAGEN) and washed and eluted according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Genomic DNA was extracted using the Genomic tip 20/G kit (Qiagen) per the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... followed by two purification steps with Genomic tip 500/G (QIAGEN, Germany). To generate a high-quality genome assembly ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA was isolated using the Genomic-tip 100/G columns (Qiagen) according to “Protocol ...