Labshake search
Citations for Qiagen :
151 - 200 of 1575 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were first purified using nickel-nitrilotriacetic acid (NTA) agarose resin (Qiagen), and the His8-SUMO tag was then removed by TEV protease (10:1 w/w ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial nucleic acid was extracted using the EZ1 DNA tissue kit (Qiagen, Germany) on EZ1 Advanced XL (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) on a rocker for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: Locked nucleic acid GapmeR antisense oligonucleotides (LNA ASOs) targeting LINC01432 (Qiagen, cat# 3653410) and CELF2 (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... resuspended in 500 µL ribonucleic acid (RNA) protect bacterial reagent (Qiagen, Cat. # 76506), allowed to incubate at room temperature for 10 minutes followed by centrifugation at 5,000 x g for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... nucleic acid was extracted from cells or tissues using DNeasy mini kit (Qiagen). HIV-1 DNA was quantified by real-time PCR ...
-
bioRxiv - Biophysics 2024Quote: ... Affinity purification was performed using nickel nitriloacetic acid (Ni-NTA) affinity column (Qiagen) attached to an AKTA™ start system (Cytiva) ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The studies were carried out on a Rotor-Gene Q 6 plex (QIAGEN) instrument at a heating rate of 2 °C/min and a temperature range of 25-90 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 6 dpf larvae (RNeasy Plus Mini Kit; Qiagen) and reversed transcribed (iScript Reverse Transcription Supermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The 6 PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) to eliminate byproducts.
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 6-well plates using miRNeasy Mini Kits (QIAGEN 217004) with the inclusion of an on-column DNase digestion (QIAGEN 79254) ...
-
bioRxiv - Biochemistry 2024Quote: ... The 6×His-tag-FACT complex was captured with Ni-NTA beads (Qiagen) while rotating at 4 ℃ for 1 hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... and the soluble homogenates were purified by Ni-nitrilotriacetic acid (NI-NTA) Agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids were extracted from frozen faecal aliquots using the RNeasy PowerMicrobiome kit (Qiagen). The manufacturer’s protocol was modified by the addition of a heating step at 90°C for 10min after vortexing and by the exclusion of DNA-removal steps ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Systems Biology 2021Quote: ... The supernatant was loaded on a nickel nitrilotriacetic acid (Ni-NTA) resin (Qiagen GmbH) column ...
-
bioRxiv - Cell Biology 2021Quote: ... We purified the 6xHIS fusion protein on nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acids were extracted with the Qiagen Power Fecal Pro kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
Heterologous expression of Dehalobacter spp. respiratory reductive dehalogenases in Escherichia colibioRxiv - Microbiology 2021Quote: ... and nickel-nitrilotriacetic acid (Ni-NTA) agarose resin was purchased from Qiagen (Hilden, Germany). PCR reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nucleic acids were subsequently extracted using the AllPrep DNA/RNA Mini Kit (QIAGEN, #80204) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The enzyme was purified through a nickel-nitrilotriacetic acid column (Ni-NTA superflow, Qiagen), which was followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1.2 µM custom template-switching oligo with a Locked Nucleic Acid analog (Qiagen) at 42°C for 90 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid locations were confirmed through sequence alignment using MacVector and CLC Workbench (QIAGEN).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Microbiology 2022Quote: Total nucleic acids were extracted in duplicate using the PowerSoil-Kit (MO-BIO, Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... S1 RBD was purified from the culture supernatant by nickel–nitrilotriacetic acid agarose (Qiagen), and purity was confirmed to by >95% as judged by coomassie stained SDS-PAGE ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... coli Rosetta cells was carried out using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) as described in Barja and Rodríguez-Concepción (2020) ...
-
bioRxiv - Molecular Biology 2021Quote: ... we added 70 µl of Ni-NTA (Nickel Nitrilo-triacetic Acid) agarose beads (Qiagen), and incubated the mixture overnight at the orbital rotator at RT ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 ml of culture supernatant was incubated with nickel-nitrilotriacetic acid-agarose beads (QIAGEN). The beads were washed ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was applied to a 5 ml nickel-nitrilotriacetic acid column (Qiagen, Valencia, CA) that had been equilibrated with buffer A at a rate of 1 ml/min ...
-
bioRxiv - Immunology 2024Quote: ... Proteins were purified from filtered supernatants using nickel nitriloacetic acid (Ni-NTA) agarose (QIAGEN) via gravity flow ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acid extraction was carried out using DNeasy PowerSoil Pro Kit (QIAGEN, Hilden, Germnay) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... After purification of AtH2B.9 using nickel-nitrilotriacetic acid agarose (Ni-NTA) resin (QIAGEN), the His6-tag portion was removed by TEV protease (30 µg/mg of His6-H2B.9) ...
-
bioRxiv - Biophysics 2022Quote: The obtained supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) in a rotating shaker for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The clarified lysate was incubated with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (Qiagen) for 1 hour with agitation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the clarified lysate was loaded on a Ni-nitrilotriacetic acid (NTA) agarose column (Qiagen) using the ÄKTA Explorer fast protein liquid chromatography system (FPLC ...
-
bioRxiv - Developmental Biology 2023Quote: ... specific locked nucleic acid (LNA) probes doubly-labelled with digoxigenin were purchased from Qiagen and ISH was conducted following the published protocol (Chen et al. ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... Soluble RBD was purified under denaturing conditions using a nitrilotriacetic acid-Ni2+ column (Qiagen)[19] ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatant was loaded onto a nickel-nitriloacetic acid (Ni2+-NTA) column (Qiagen, Hilden, Germany), washed with 500ml buffer A ...