Labshake search
Citations for Qiagen :
151 - 200 of 528 citations for 4 Maleinimido phenyl isocyanate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... total RNA was harvested from BMDM 4 hours post-treatment per Qiagen RNA extraction protocol (QIAGEN). RNA was then reverse transcribed to cDNA using iScript Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Evolutionary Biology 2019Quote: ... Four 2-mL aliquots of culture were thoroughly mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) and incubated at room temperature for 5 min before centrifugation at 4,000 × g for 12 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed 4 times with 1 ml of IP buffer and 700 μl of Qiazol (Qiagen) was directly added to the beads ...
-
bioRxiv - Physiology 2020Quote: ... DNA was isolated using Qiagen MagAttract PowerMicrobiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) on the EpMotion 5075 (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Microbiology 2020Quote: ... The soluble fraction was incubated for 1 hour at 4 °C using a Ni-NTA resin (Qiagen). The Ni-NTA resin was washed with 4 times resin volume (RV ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from 4 mg of ground lyophilized material using the RNeasy Midi kit (Qiagen). A DNase treatment (Ambion ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated for ~2 h rotating at 4°C with Ni-NTA Resin (Qiagen, 1018244) that had been washed with wash buffer (20mM Tris HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2022Quote: Cell pellets or pieces of xenografts were lysed in 4% SDS buffer using a QIAshredder (Qiagen, 79654). See Supplementary Table S1 for antibodies used ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from 4×107 KPC cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen). NGS libraries were prepared using the following primers:
-
bioRxiv - Microbiology 2020Quote: ... RNA extraction was performed from homogenate of 4 mg of lung tissue with RNeasy Mini Kit (Qiagen), or 50µl of serum using the NucleoSpin kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2022Quote: ... 97-mer shRNA oligonucleotides were synthesized (IDT) and 4 picomoles were amplified with HotStarTaq polymerase (Qiagen#203207) using the primers miR-E-fw (5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plates were coated with 100 μL of 4 μg/mL murine anti-His mAb (Qiagen, #34660), and after blocking ...
-
bioRxiv - Pathology 2021Quote: ... at 4°C and total RNA was extracted with the RNeasy Midi kit (Qiagen, Santa Clarita, CA). Mouse Genome 430A 2.0 arrays (Affymetrix ...
-
bioRxiv - Systems Biology 2019Quote: ... n=4/group/strain for hypothalamus) using All-Prep DNA/RNA/miRNA Universal Kit (Qiagen, CA. USA). mWAT was chosen due to its stronger implications in MetS than other fat depots (14) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were kept at 4° for two days before extracting DNA using the DNeasy PowerSoil Kit (Qiagen). We also obtained DNA extracted from ...
-
bioRxiv - Genomics 2021Quote: ... sativa seedlings (∼1.5 weeks) and mature leaves (∼4 weeks) using the DNeasy Plant Mini kit (Qiagen #69104) and diluted to 5 ng/μl ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
bioRxiv - Immunology 2020Quote: 4 matched pairs of Treg and MulTreg were expanded and RNA extracted (RNeasy RNA extraction kit, Qiagen). cDNA was then produced (SMART cDNA synthesis kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... 565 E.coli colonies per guide ratio (>500x coverage) was used to process the 4 Maxi-Prep (Qiagen) reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°) and plasmids were extracted from the cell pallets using QIAprep Spin Miniprep kit (Qiagen, CA, USA). The sequences of the inserts were confirmed by Sanger sequencing (ACGT Inc ...
-
bioRxiv - Immunology 2022Quote: ... After mechanical disruption by shaking at 25/s over 4 min with metal beads (TissueLyser II, Qiagen), two 250 μL aliquots of the homogenate were stored at -80°C for viral plaque titration ...
-
bioRxiv - Genomics 2022Quote: ... and homogenized at 25/s for 1 min at 4°C using a TissueLyser II (Qiagen, 85300). Samples were incubated at room temperature for 5 min followed by addition of 180 μl chloroform ...
-
bioRxiv - Plant Biology 2022Quote: ... the clear supernatant was incubated for 4 h with 1.5 ml Ni-NTA agarose (Qiagen, Hilden, Germany) previously washed with 6 ml of distilled H2O and equilibrated with 6 ml of binding buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... Four wells were then harvested at the appropriate growth stage and combined with 4 mL RNAprotect (Qiagen) to generate each replicate ...