Labshake search
Citations for Qiagen :
151 - 200 of 1477 citations for 3 2 Methoxy phenoxymethyl piperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs targeting the 3’UTR of Arhgap11a were purchased (siRNAflex, Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was incubated with 3 ml Ni-NTA resins (QIAGEN) with gentle agitation at 4 °C for an hour ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...
-
bioRxiv - Bioengineering 2023Quote: ... containing 3 μL 4X Probe PCR Master Mix (250102, Qiagen, USA) (final concentration 1X) ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated with binding buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antisense LNA GapmeRs (custom designed, 3’-FAM-labeled, Qiagen, Table S5) were bilaterally microinfused using a 2 μl calibrated micropipette (Hamilton syringes ga 25/70mm/pst3) ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), aliquoted ...
-
bioRxiv - Microbiology 2024Quote: ... and 3) DNA extraction (using here DNeasy Blood & Tissue kit, Qiagen) from the pellet for molecular analysis to detect E ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD11 (Qiagen, Sequence: 5′-TGC TAG CGA AGT CAG A-3′), HOXD13 (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD13 (Qiagen, Sequence: 5′-CAT CAG GAG ACA GTA T-3′), for 24hr and 48hr for RNA and protein extraction respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25 uL T7 Ligase (3×10^6 U/mL) (Qiagen Enzymatics), 15 ng purified amplicon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence (AACTGTAGGCACCATCAAT) was trimmed based on vendor’s recommendation (Qiagen). After adaptor trimming ...
-
bioRxiv - Microbiology 2023Quote: ... then resuspended in 3 mL of RNAprotect for bacterial cells (Qiagen, #76506). Planktonic cultures were similarly pelleted and resuspended in RNAprotect ...
-
bioRxiv - Neuroscience 2024Quote: Colon tissue fragments (3 mm, proximal colon) were stored in RNAlater (Qiagen) overnight at 4c ...
-
bioRxiv - Microbiology 2024Quote: ... the tissue samples were homogenised using 3 mm stainless steel beads (Qiagen) and a TissueLyser II (Qiagen ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated overnight with 3 ml Ni-NTA beads (Qiagen) preequilibrated with the extraction buffer ...
-
bioRxiv - Immunology 2023Quote: Tissue was homogenized by using sterile 3-mm tungsten carbide beads (QIAGEN) in a TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2024Quote: ... tailbuds were individually lysed in 3 μL of RLT + BME (Qiagen RNeasy) and stored in separate PCR tubes at −80 °C to await genotyping of heads (for rad21-/- and rad21+/-) ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA was isolated from 3 dpf TL embryos (RNeasy, Qiagen; RNAlater, Invitrogen), and AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...