Labshake search
Citations for Qiagen :
151 - 200 of 3491 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... incubated 2 hr with 5 mL of packed Ni-NTA agarose beads (Qiagen), filtered (0.45 µm Millex-HP PES membrane filter unit ...
-
bioRxiv - Microbiology 2020Quote: Each dissected compartment (legs and thoraxes) was homogenized individually 3 x 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9-10 mL of Buffer BB (1/3 of the lysate volume, From QIAGEN Plasmid Plus Midi Kit) was added ...
-
bioRxiv - Bioengineering 2023Quote: Each body part (legs and thorax) was homogenized individually for 3 × 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Immunology 2024Quote: Total RNA from roughly 1-3 million thawed patient PBMCs was extracted using a RNeasy Mini Extraction kit (Qiagen) and reverse transcribed to cDNA using oligo-DT primers and the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR 2 products were purified by 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), eluting with 15 μL of Elution Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were homogenized in a mixture of chloroform and methanol (2:1) using TissueLyser II (Qiagen) and dried in a Vacufuge (Eppendorf ...
-
bioRxiv - Immunology 2021Quote: DNA from 1-2 stool pellets was extracted using the QIAamp DNA Stool Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures samples were then mixed 1:2 with RNA Protect Bacteria Reagent (QIAGEN, Germantown, Maryland, USA), vortexed immediately for 5 seconds and incubated for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were then treated with DpnI for 1-2 hr and then purified (QiaQuick, Qiagen) before use in library construction.
-
bioRxiv - Microbiology 2023Quote: ... each spot was collected into a 1:2 mix of LBS and RNAprotect Bacteria reagent (Qiagen), incubated at RT for 5 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... About 1 OD/mL cells were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, 76506), and the cell pellet was collected by centrifuging at 2500 g for 8 minutes at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... DNA was extracted from 1 or 2 bumblebee legs using the DNeasy Blood & Tissue kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA (gDNA) was extracted from 1-5×106 cells using DNeasy Blood and Tissue Kit (Qiagen) and 250 ng gDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: mESC gDNA was purified from 1-5 million cells using the QIAamp DNA mini kit (Qiagen 51306) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... samples were defrosted and incubated in 1 ml of RNAprotect cell reagent (Qiagen, 5 min, 25°C). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation of 1 µl 5′RACE PCR products were performed with the Qiagen PCR cloning kit (Qiagen) according to the manufacters protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 5 ml of the supernatant were added to 1 ml of Nickel-NTA Agarose (Qiagen, Hilden, Germany) and incubated under continuous shaking at 4 °C for 1 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Bioengineering 2020Quote: Around 250 mg of each produce sample was cut into 1-3 mm pieces using a scalpel and then processed with the DNeasy Powersoil Pro kit (Qiagen) to isolate 50μL of eluted DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was purified 1-3 dpi from mock- or POWV-infected hBMECs or hPCs using RLT lysis buffer and RNeasy columns (Qiagen). Purified RNA was quantitated ...
-
bioRxiv - Genomics 2022Quote: ... Formalin-Fixed Paraffin-Embedded (FFPE) tissue (3 samples) and fresh frozen tissue (1 sample, QiaAmp Blood mini kit, QIAcube, QIAgen). Two samples are reference samples (NA24385 and NA12892 ...
-
bioRxiv - Genomics 2022Quote: ... the supernatants were mixed with Sigma HIS-Select Nickel Affinity Gel (at a ratio of 3:1) equilibrated in lysis buffer before being added into a polypropylene column (Qiagen). After extensive washing with a cold lysis buffer ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LNA gapmers for lnc-FLii-1 and lnc-LSAMP-3 were designed and purchased along with negative control LNA from Qiagen. For transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Pathology 2024Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl diluted cDNA (1:20) were added to SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and 10 μM of both forward and reverse primer (Primer Sequences Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were homogenized for 2 × 1 min at 30 Hz using a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until further processing.
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...