Labshake search
Citations for Qiagen :
151 - 200 of 3700 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the leaves of 4-to-6-week old plants using the RNeasy Plant Mini Kit (Qiagen). RNA concentrations were quantified using a Qubit RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... We extracted total RNA from 10 leaves that were shorter than 500 µm and from 4–6 mature leaves using the RNeasy Micro Kit (Qiagen) and the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 250 to 1000 μm lengths of epithelium sections were microdissected from 4 to 6 successive serial sections and DNA extracted using a QIAMP DNA microkit (Qiagen) by digesting overnight and following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNAs were prepared from livers of rats subjected to inhalational anesthesia with sevoflurane or desflurane for 6 hours or less than 1 minute using an RNeasy Midi Kit (QIAGEN, Venlo, Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Neuroscience 2020Quote: ... containing Protease inhibitor cocktail (PIC, Complete, 1:25) and lysed at 4°C using a TissueLyser LT (Qiagen) on 50 Hz for 2 min ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Each sample was mixed with 5 µL of one of 6 Illumina adapter sequences (specified in the Qiagen protocol appendix) and 2 µL of ultralow input ligase ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 15 mM DTT) and then treated with 2 μL of 4 mg/mL Protease (QIAGEN) by incubation at 55°C for 6 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl diluted cDNA (1:20) were added to SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and 10 μM of both forward and reverse primer (Primer Sequences Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were homogenized for 2 × 1 min at 30 Hz using a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until further processing.
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were homogenized (2 x 1 min at 30 Hz) by a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until next step ...
-
bioRxiv - Molecular Biology 2024Quote: ... filtered and incubated with Ni-NTA Agarose (Qiagen, 1 mL slurry per 2 L of cell culture) for 1h ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Neuroscience 2020Quote: ... RAGE-/- and SOD1G93A x RAGE-/- mice (n = 5 - 6) using RNeasy Lipid Tissue extraction kit according to manufacturer’s instructions (QIAGEN, CA, USA). The total RNA was purified from genomic DNA contamination using Turbo DNase treatment (Ambion ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from TG and NTG mice (n=4/group) at 6 months of age using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA from 1-5 million total CD4+ T cells was isolated using the Gentra Puregene Cell Kit (Qiagen) or phenol-chloroform and the DNA concentration was measured by Qubit High Sensitivity Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: The LRH-1-10CA-TIF2 complex was concentrated to 5 mg/mL and screened using the Classics screen (Qiagen) and a Phoenix Liquid Handler (Art Robbins Instruments ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).