Labshake search
Citations for Qiagen :
1901 - 1950 of 4028 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Total RNA was isolated from 1 million cells per condition using the RNeasy Plus Mini Kit (Qiagen, 74104). mRNA was isolated using the Poly(A ...
-
bioRxiv - Biochemistry 2023Quote: ... Negatively supercoiled pHOT-1 DNA was purified from DH5α utilizing a Qiagen Plasmid Midi Kit (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2023Quote: ... Cell pellets were washed with 1× PBS and RNA were extracted using the RNeasy plus mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was extracted from 1 x 106 transduced HEK293T cells with the RNeasy Plus Mini Kit (Qiagen, #74134) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μL of bisulfite treated DNA was amplified for the regions of interest using PyroMark PCR kit (Qiagen) with final primer concentration of 0.4 μM ...
-
bioRxiv - Genomics 2023Quote: ... DNA was isolated by phenol:chloroform:isoamylalcohol (25:24:1 pH 8) extraction followed by Qiaquick PCR Purification (QIAGEN, Germany). Purified DNA was then analyzed on a 1.5% agarose gel and on Bioanalyzer (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: Approximately 1 cm of the mouse distal ileum was cut into small pieces and stored in RNAlater (Qiagen). RNA was prepared using a combination of Trizol (Ambion ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then disrupted by sonication and the supernatant was mixed with 1 mL Ni-NTA agarose (QIAGEN) and incubated for 1 h at 4 °C with gentle shaking ...
-
bioRxiv - Immunology 2023Quote: ... Total DNA was obtained from the lysed inoculated THP-1 macrophages using DNeasy Blood & Tissue Kit (Qiagen, Germany). The amplification reaction was performed in a 20μl final volume containing 1μl of template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of culture was withdrawn and chromosomal DNA extracted using the Dneasy blood and tissue kit (Qiagen). The samples were normalized according to DNA concentrations and diluted 1:5 ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA extraction was carried out using one of the following methods: 1) QIAmp DNA Mini Kit (Qiagen, Germany); 2 ...
-
bioRxiv - Systems Biology 2023Quote: ... Amplicons were gel-purifed from a 1 % Agarose gel using the QIAquick Gel Extraction Kit (QIAGEN, Düren, Germany). After determining the concentration with Qubit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was isolated from 1 mL of overnight culture of each genotype (DNeasy Blood & Tissue Kit; Qiagen). Paired-end ...
-
bioRxiv - Cancer Biology 2023Quote: ... Up to 1 ug of RNA was converted into cDNA using either the Quantitect Reverse Transcription kit (QIAGEN) or the Superscript IV transcription kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... All treatment groups were supplemented with 1 % FCS and RNA was extracted in RNAeasy Plus lysis buffer (QIAGEN) 6 h post treatment.
-
bioRxiv - Genomics 2023Quote: ... V6.5 mESCs and K562 genomic DNA was purified from 1 million cells using the QIAamp micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was loaded using a peristaltic pump in 1 mL (bed volume) of Ni-NTA agarose (QIAGEN) packed in a Poly-Prep® Chromatography Column (Cat #731-1550 ...
-
bioRxiv - Systems Biology 2024Quote: Fragments were purified by adding 300µL phenol:chloroform:isoamyl alcohol (25:24:1 v/v) and sample to a phase lock tube (Qiagen #129046), and spun down at 16,000g for 3 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... or Disp-/- cells were seeded into six-well plates and transfected with 1 µg Shh constructs together with 0.5 µg Scube2 or empty cDNA3.1 by using Polyfect (Qiagen). Where indicated ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from 1 x 108 trypanosome cells using the Qiagen RNeasy Mini Kit (Qiagen, Netherlands) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Tissues were then resuspended in 1 mL of lysis buffer from the RNeasy Fibrous Tissue Mini Kit (Qiagen) and processed as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 µg of the isolated total RNA was transcribed using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). The quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...
-
bioRxiv - Molecular Biology 2019Quote: Body tissue of medaka at 3 dph was minced and then processed with a RNeasy Minikit (Qiagen) for extraction of total RNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mL were collected and used for plasmid extraction using a QI-Aprep Spin Miniprep kit (QIAGEN). Extracted plasmids were eluted in 30 μL of elution buffer and stored at −20 °C until use.
-
bioRxiv - Bioengineering 2022Quote: Total RNA content was extracted from 3 biological replicates using RNeasy® Plus Mini kit (#74134, Qiagen) following manufacture’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Extraction method 3 used a modified version of the Qiagen QIAamp Mini DNA kit (Qiagen, Venlo, Netherlands). Following initial pelleting ...
-
bioRxiv - Microbiology 2022Quote: ... 1ml of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized for 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... The samples (N=3) were collected immediately and soaked in 10 volumes of RNAlater (Qiagen, Hilden, Germany), for sequencing using Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then washed 3 x with ice-cold 1x PBS and lysed in RLT buffer (Qiagen) with 1/100 β-mercaptoethanol (Sigma ...