Labshake search
Citations for Qiagen :
1901 - 1950 of 2085 citations for 6 BROMO 2 METHYL QUINOLINE 4 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The supernatant was then purified using a modified PB buffer and eluted using 2 washes in 18 μl buffer EB (QIAGEN) - with 3 min of incubation time at 37°C (Dabney et al ...
-
bioRxiv - Genetics 2023Quote: ... Whole blood was collected in 2% SDS Queens lysis buffer [23] and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen). All research was approved by the Institutional Animal Care and Use Committee at Columbia University (AC-AAAW6451) ...
-
bioRxiv - Genomics 2023Quote: ... to the eluted samples and digestion was carried out for 2 hours at 55°C followed by PCR purification (Qiagen). Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from 2 h and 10 h RPMI-grown and macrophage-internalized Cg cells using the RNeasy kit (Qiagen), followed by DNase I digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Biochemistry 2023Quote: ... Crystals were grown at 30°C by the hanging drop vapor diffusion method using 2 μL sample drops and 300 μL crystallization solution in a sealed chamber (EasyXtal 15-Well Tool, Qiagen). Crystals were soaked for 1h (for the Na structure or with the dibromo Intronistat B derivative ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from kidneys of three independent biological samples for each age (E17.5, 2 months) and genotype using an RNeasy Mini Kit (Qiagen 74104) with on-column DNAse I treatment ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: Total RNA was extracted from 2-week-old seedlings grown on an MS plate using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Genetics 2023Quote: ... Digests were incubated for 2 hours at 37°C then purified using a QiaQuick PCR purification kit (Qiagen Cat#28106). Fragments of 2100 bp were size-selected using a SageELF instrument (Sage Science ...
-
bioRxiv - Genetics 2023Quote: ... The leaves were ground in liquid nitrogen and powder was resuspended in 2 ml of RLT buffer from RNeasy Plant Mini kit (Qiagen). For each sample ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted directly into 2-Mercaptoethanol-containing RLT buffer and RNA was extracted using a RNeasy Mini kit (Qiagen). The cell populations used for RNA sequencing are summarized in Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Pathology 2023Quote: ... RNA from CD4+ T cells (2×106 cells per condition) was extracted by using the RNeasy Plus Mini kit (QIAGEN). Extracted total RNA was quantified using the Qubit broad range RNA assay ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Genetics 2024Quote: ... yeast plasmid DNA was extracted from 5x107 cells harvested off of galactose and final glucose plates of replicates 2 and 3 using Qiaprep Spin Miniprep Kit (QIAGEN). We amplified the 200-bp repair template region from the initial E ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 8 liver samples (2 from each lobe) were obtained on necropsy and processed with the DNeasy Blood and Tissue Kit (QIAGEN) as per the manufacturer’s instructions to isolate genomic DNA ...
-
bioRxiv - Immunology 2024Quote: ... Expression of target ncRNAs in CH12F3 and primary B cells were inhibited by 2 µM miRCURY LNA miRNA Inhibitors (339131, Qiagen), anti-miR-5099 (GGAGCACCACATCGATCTAA-FAM) ...
-
bioRxiv - Immunology 2024Quote: ... Overexpression of miR-5099 in CH12F3 was achieved by transfecting 2 µM of miR-5099 miRCURY LNA miRNA mimic (Qiagen) by electroporation using Lonza 4D-Nucleofector and cell line SF kit following manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was extracted from the mouse blood sampled after feeding the mosquitoes (Barcode input 2) using DNeasy Blood and Tissue Kit (Qiagen). The parasite gDNA was extracted from the infected mosquito midguts 14 days post-infection (Barcode output ...
-
bioRxiv - Molecular Biology 2024Quote: ... and HET(2)) and four biological replicates of PA-1 (WT and HET) cells was extracted using miRNeasy Mini Kit (Qiagen) followed by on-column DNAse digestion ...
-
bioRxiv - Developmental Biology 2024Quote: ... approximately 2×106 cells per well were washed with cold PBS and lysed using Buffer RLT (Qiagen, catalog no. 79216). RNA extraction was performed according to the manufacturer’s protocol (RNeasy Mini Kit ...
-
bioRxiv - Immunology 2024Quote: ... was added to each tube and homogenized at 30 rev/s for 3 minutes for 2 rounds using a tissue homogenizer/lyser (#9003240, Qiagen). Kidney extracts were centrifuged at 17,000 RCF for 10 minutes and the supernatant was transferred to a 1.5 mL microcentrifuge tube and kept over ice for 1-2h ...
-
bioRxiv - Genetics 2024Quote: ... DNA samples (70–80 oocytes and 7–10 blastocysts per sample) were subjected to bisulfite conversion through 2 µg carrier RNA (QIAGEN). Nested PCR was performed using EpiTaq HS with the primers listed in Supplementary Table 4 ...
-
bioRxiv - Genomics 2024Quote: ... The amplicon library pools were isolated based on size by gel electrophoresis using a 2% agarose gel and then purified using QIAEX II Gel Extraction Kit (QIAGEN) and using 30uL of QIAEX II beads for each sample ...
-
bioRxiv - Physiology 2024Quote: ... was mechanically homogenised in TRI reagent with a 5 mm steel bead at 30 Hz for 2 x 30 s (TissueLyser II, Qiagen) then centrifuged for 10 min at 10,000 g ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were centrifuged at 16,000 g for 5 min and supernatant was treated with 4 µL of RNase A (100 mg/mL) (Qiagen Singapore Pte. Ltd, Cat. No. 19101), gently mixed by flicking of tube and incubated at room temperature for 2 min ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed twice with the blocking buffer and incubated at 4 °C with primary antibodies (mouse anti-Strep, Qiagen, Cat #: 34850, 1: 150 dilution) (rabbit anti-PDI ...
-
bioRxiv - Genomics 2022Quote: An aliquot of 150 μL of plasma per sample was thawed on ice and centrifuged at 3000 × g for 5 min at 4 °C and smallRNA was extracted using miRNeasy Serum/Plasma Kits (Qiagen, Cat. No. 217184, Milano, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... snap frozen samples were homogenized in an Eppendorf tube using a 3-mm Tungsten carbide beads and TissueLyser II system (Qiagen; 4 min at 30 Hz). RNA isolation steps were followed as mentioned above in this section ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Plant Biology 2019Quote: ... 50,000 protoplasts in a volume of 100 μL were transformed with 20 μg of each plasmid (2 μg/μL) purified using the Plasmid Maxi kit (Qiagen, Germany). One batch of protoplasts was treated with an equivalent amount of water and used as the negative (untransformed ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...