Labshake search
Citations for Qiagen :
1851 - 1900 of 4272 citations for 6 METHYL 2 OXO 4 THIOPHEN 2 YL 1 2 3 4 TETRAHYDRO PYRIMIDINE 5 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Nucleic acids were extracted from leech samples using the DNeasy 96 Blood & Tissue kit (Qiagen) (see Axtner et al ...
-
bioRxiv - Microbiology 2022Quote: ... nucleic acid was extracted from the tissue sample using QIAamp DNA extraction kit (Qiagen, Germany) as per the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD USA) with optional on-column DNase treatment according to the manufacturer’s instructions (no carrier RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tumor nucleic acid extractions were performed using the Allprep DNA/RNA/miRNA Universal kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the QIAamp Circulating Nucleic Acid kit (kit Q; cat# 55114, Qiagen, Germantown, MD, USA).
-
bioRxiv - Microbiology 2020Quote: Total nucleic acid was extracted from respiratory specimens using a QIAamp DNA Mini Kit (QIAgen), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The soluble fraction was passed through 3ml of nickel nitrilotriacetic acid agarose (Ni-NTA) (Qiagen), washed with 20 mM imidazole ...
-
bioRxiv - Genomics 2019Quote: ... Extraction of nucleic acids was performed using the QIamp DNA FFPE extraction kit (Qiagen Ltd.) according to manufacturer’s recommendation.
-
bioRxiv - Cell Biology 2021Quote: The locked nucleic acid-modified oligonucleotides with a fully phosphorothioate backbone were produced by Qiagen as described (Rossiello et al ...
-
bioRxiv - Developmental Biology 2020Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... cfDNA was extracted from 4ml of plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN, 55114), it was quantified via Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CSF3R protein was enriched by nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen 30210) and further purified by size-exclusion chromatography on a Superdex 75 10/300 GL column (Cytiva 17517401 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Genomic nucleic acid isolation was performed using the MagAttract HMW DNA Kit (Qiagen, Hilden Germany) precisely following the instructions of the fresh or frozen tissue protocol ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Recombinant Fab proteins were purified from the culture supernatant by nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant mAbs were affinity purified by MabSelect resin (Cytiva ...
-
bioRxiv - Genomics 2022Quote: ... Viral nucleic acids were then isolated using QIAamp MinElute Virus Spin Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions with some modifications described (Cosentino et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... A locked nucleic acid probe (mmu-miR-450b-5p miRCURY LNA miRNA Detection probe; Qiagen) was used to detect miR-450b while standard DNA oligonucleotide probes were used for other miRNAs ...
-
bioRxiv - Developmental Biology 2023Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and nucleic acid was extracted using EZ1 Advanced XL extraction with a Virus Card (QIAGEN). Six of the 20 FACS populations did not generate sufficient DNA and were not subsequently sequenced ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribonucleic acid (RNA) was extracted and purified using RNeasy RNA Isolation Kit (QIAGEN, Germantown, MD) then reverse transcribed into complementary deoxyribonucleic acid (cDNA ...
-
bioRxiv - Genomics 2024Quote: ... CfDNA was extracted from the plasma samples using the QIAamp Circulating Nucleic Acid Kit (Qiagen) and approximately 3 – 8 ng of cfDNA was isolated from each plasma sample for use in the 5hmC-Seal assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then lysed 3 times in a pre-cooled TissueLyser (QIAGEN). Proteins were dissolved in lysis buffer (4% SDS ...
-
bioRxiv - Cell Biology 2019Quote: ... Table 3 in the Rotor Gene Q 2plex cycler (Qiagen).
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2023Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...