Labshake search
Citations for Qiagen :
1701 - 1750 of 4207 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... total RNA was harvested from BMDM 4 hours post-treatment per Qiagen RNA extraction protocol (QIAGEN). RNA was then reverse transcribed to cDNA using iScript Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Molecular Biology 2020Quote: ... while method-3 was a modified protocol of the DNeasy PowerMax Soil Kit (Cat.No. 12988-10) provided by Qiagen (based on communication exchanged with the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: Transduced GFP+ LT-HSCs from 3 independent biological replicates were sorted directly into 350 ul of RLT buffer (Qiagen). Total RNA was isolated from cells using the RNeasy Micro kit (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was purified from cell passage number 3 using the RNeasy RNA purification kit (Qiagen Cat. No. 75142). A260:280 ratio > 2 and RIN > 9.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tissue samples were homogenized in 3 mL sterile PBS for 20 seconds on ice using a TissueRuptor homogenizer (Qiagen) with sterile tips ...
-
bioRxiv - Genomics 2022Quote: ... 50 ng of total RNA was processed up to 3’ adapter ligation step according to the manufacturer’s instruction (Qiagen). The adapter-ligated RNA was treated with 5U of RppH (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted at 3 hpi and 24 hpi with the RNeasy Mini Total RNA extraction kit (Qiagen). SARS-CoV-2 RNA was detected with the CDC assay kit (IDT ...
-
bioRxiv - Bioengineering 2022Quote: ... transfected cells were harvested on Day 3 and genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN # 69506). The region surrounding EMX1 target site was amplified with EMX1-F ...
-
bioRxiv - Immunology 2019Quote: ... Input material (total cytoplasmic mRNA) and efficiently translated mRNA (heavy polysome-associated, >3 ribosomes) were extracted with QIAzol (Qiagen) and purified using RNeasy MinElute Cleanup Kit (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... Seedlings of 3-week-old plants were used to extract total RNAs using the RNeasy Plant Mini Kit (Qiagen). Total RNAs were treated with amplification-grade RNase-free DNase I (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Individual tumors were collected in low binding DNA tubes and digested in 3 μl RLT buffer (Qiagen Cat# 1048449) for 30min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Sample tubes were transferred back to ice before 3 rounds of 60 second bead beating on the TissueLyser2 (Qiagen). Samples were incubated at room temperature for five minutes before 200 µL of chloroform (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were harvested 3 days later by direct application of buffer RLT from the RNeasy mini kit (Qiagen 74104).
-
bioRxiv - Microbiology 2022Quote: ... homogenized in 500 μl PBS by bead beating (3 mm steel ball, 25 Hz for 2.5 min in a TissueLyser (Qiagen)) ...
-
bioRxiv - Plant Biology 2022Quote: 3 μg total RNA was extracted from each flower bud sample using Tiangen Polysaccharide and Polyphenol Kit (QIAGEN, Germany). After passing the quality inspection ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from 50-80 mg of surface-sterilised (70% EtOH, 0.1% Triton X-100) and 3-days germinated seeds with RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 100 mg of seedlings at 3 dpg by means of the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... The samples were loaded on a EconoSpin column and the RNA was washed 3 times with RPE buffer (QIAGEN). The RNA was eluted with distilled nuclease free water ...
-
bioRxiv - Biochemistry 2023Quote: ... the lysate was centrifuged at 15,000 x g for 35 mins and the soluble fraction incubated with 3 mL of Ni-NTA beads (Qiagen) for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... oxydans wild-type cultures at OD600 0.3 units (Exp) or 3 units (Sta) using the RNeasy Mini Kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The genomic DNA (gDNA) from 3 whole-brain sections per group was isolated by QiaAmp DNA microkit (Qiagen 1048145) and the concentrations were measured by Qubit DNA HS kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... The excess dsDNA was removed by 3 rounds of PCR clean up with QIAquick PCR Purification Kit (Qiagen, 28106).
-
bioRxiv - Bioengineering 2024Quote: ... spun down for 15 s at 8,000 g and eluted 3 times by adding 700 µL Buffer RW1 (Qiagen) and spinning ...
-
bioRxiv - Immunology 2019Quote: ... the 250 genes comprising the signature of time since exposure to an active TB case (6 months vs. baseline) were analyzed using canonical pathway analysis with QIAGEN’s Ingenuity® Pathway Analysis platform (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity). To compare transcriptional modules that were concordantly or discordantly regulated between mice ...
-
bioRxiv - Cell Biology 2022Quote: ... After 72 h cells were passaged onto new 6-well plates and culturing continued for an additional 72 h after which cells were harvested in Buffer RLT (Qiagen; for RNA-sequencing, RT-qPCR) or used for cell culture experiments.