Labshake search
Citations for Qiagen :
1701 - 1750 of 3920 citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and 6 were performed to extract RNA using the RNeasy Plus Universal Kit (Qiagen, Hilden, Germany) and protein using an SMA enzyme-linked immunosorbent assay (ELISA ...
-
bioRxiv - Immunology 2023Quote: ... Transfection of siRNA was performed overnight using 6 nM for each siRNA with HiPerFect reagent (QIAGEN) according to the manufacturer’s reverse transfection protocol ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was extracted from 1-to 2-mm-long tail tips using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). Genomic DNA (5 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR was performed using the TaqMan™ RNA-to-CT™ 1-Step kit (Thermo Fischer Scientific) and was run in a RotorGene-6000-2-plex (Qiagen). PCR conditions having reverse transcription at 48’C for 15 min ...
-
bioRxiv - Immunology 2022Quote: ... of soluble SARS-CoV-2 WA1 and SARS-CoV-2 Omicron BA.1 spike trimers were isolated from cell supernatants using a Ni-NTA column (Qiagen, Hilden, Germany). Eluents from Ni-NTA purifications were subjected to SEC using a HiLoad Superdex 200 16/600 column followed by a Superose 6 10/300 (Cytiva ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit, Qiagen Germantown, MD, USA) and ran them in the tissue lyser at either ½ speed or max speed for 30 sec or 1 min ...
-
bioRxiv - Bioengineering 2021Quote: ... the mEV solution was incubated with 100 µl of precipitation buffer B from the Qiagen miRCURY Exosome Isolation Kit (Qiagen, Germantown, MD) overnight (∼12 hours ...
-
bioRxiv - Immunology 2020Quote: RNA from B1a B cells was reverse transcribed and amplified using a Qiagen OneStep RT-PCR kit (Qiagen Inc., Valencia, CA, USA) and iRepertoire® mouse BCR heavy chain (MBHI ...
-
bioRxiv - Cell Biology 2024Quote: ... tissue was snap frozen in liquid nitrogen and pulverized with a microdismembrator S (B. Braun Biotech, Melsungen, Germany) before total RNA isolation by means of the Lipid Tissue Mini Kit (Qiagen, Hilden, Germany). Isolated cells were lysed in RLT buffer ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from different parts of the seedling (Figure1 a) and the peel of fruit (Figure1 b) using RNeasy Plant Mini kit (Qiagen, Hilden, Germany). Total amounts and integrity of RNA were assessed using the RNANano 6000Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Immunology 2021Quote: ... BALF and serum was performed by quantitative reverse-transcriptase PCR (qRT-PCR) using the one-step Quantinova™ Probe RT-PCR kit (QIAGEN). Primers and a TaqMan probe were designed to hybridize to a sequence in ORF7 (encoding N) ...
-
bioRxiv - Bioengineering 2019Quote: Genes were quantified by one-step quantitative reverse transcription-polymerase chain reaction (q-PCR) using the QuantiFast SYBR Green RT-PCR kit (Qiagen, UK). A master mix was prepared by mixing 6.25 μl SYBR green ...
-
bioRxiv - Genomics 2020Quote: ... and from two “normal” males (50289,70203) and one “normal” female (20025) were collected and stored in RNAlater™ (QIAGEN, Hilden, Germany). The normal individuals may be carriers of the genetic variant(s ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of bisulfite converted DNA was used as template to amplify target genomic regions using specific primers (one biotinylated) with the PyroMark PCR kit (Qiagen, #978703), following the recommended conditions (annealing temperature 56°C) ...
-
bioRxiv - Evolutionary Biology 2020Quote: Genomic DNA was extracted from overnight cultures from one isolated colony of each stock following standard protocols (QIAGEN DNAeasy, Hilden, Germany). Extracted DNA was treated with RNase A and purified on Axygen AxyPrep Mag PCR Clean-up SPRI beads ...
-
Global genetic patterns reveal host tropism versus cross-taxon transmission of bat BetacoronavirusesbioRxiv - Evolutionary Biology 2020Quote: ... All RNA extracts were subjected to reverse transcription polymerase chain reaction (RT-PCR) using the one-step RT-PCR kit (Qiagen, USA) and PanCoV F2 (5’-AAR TTY TAY GGH GGY TGG-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... These primers were used to amplify the mRNA from the sample using Quantifast SyBR Green one –step RT-PCR kit (Qiagen, Netherlands) and the reactions were run using ABI 7500 real-time PCR instrument (Thermo Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification of a single product of the expected size by a primer pair was first confirmed by RT-PCR using Qiagen® One-Step RT-PCR kit (Qiagen) followed by agarose gel analysis of the amplified products ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µM of forward and reverse oligos were heated for one minute at 100°C with 5 mM MgCl2 and 7 mM Tris-Cl (i.e. Qiagen Elution Buffer) and annealed by slowly cooling to room temperature.
-
bioRxiv - Cell Biology 2020Quote: Cells were seeded in 6-well plates at a density of 80,000 cells/well one day prior to transfection and transfected with DR5-AS LNA GapmeR (Qiagen, United States) at a concentration of 40 nM or with 1500 ng of pcDNA3.1-DR5-AS with the Fugene HD transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the sample was divided into 5 parts and each part was purified using one PCR purification columns (PCR purification kit, Qiagen 28106). 50ul elution buffer was used the elute each column ...
-
bioRxiv - Microbiology 2021Quote: The frozen filters were retrieved and cut into two halves using sterile surgical blades and DNA was extracted from one-half using DNeasy PowerSoil Kit (Qiagen, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was quantified and qualitatively assessed using a nanodrop instrument following which one step qRT-PCR was performed using QuantiFast SYBR Green PCR kit (204054; Qiagen, Germany). Table 1 lists the primers used for mRNA quantification and cellular glyceraldehyde-3-phosphate dehydrogenase expression was used as a normalizing control ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was divided into two parts: one part was directly combined with nickel-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen, China); the other part was heated in a 65 °C water bath for 60 minutes and then centrifuged at 14000 rpm for 60 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... while URA3 and ACT1 levels were measured by one-step RT-PCR with specific primers (Supplementary Table S3) following the standard protocol of the RNeasy® Mini kit (Qiagen). All strains were propagated for at least 100 generations before analysis.
-
bioRxiv - Physiology 2020Quote: ... One μg of total RNA was reverse transcribed into cDNA using the Qiagen QuantiTect Reverse Transcription Kit (Qiagen, Valencia, California, USA) following manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 ng of each PCR product was pooled into one tube for purification using the QIAquick PCR purification kit (Qiagen #28106) and eluted into 30 µL Nuclease Free Water ...
-
bioRxiv - Genomics 2020Quote: ... high-molecular weight DNA was extracted from the entire body of one F1 pupa using a QIAGEN Blood & Culture DNA Midi Kit (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was recovered from one-month-old of the DL1YTT001 culture by using a RNeasy® PowerSoil® kit (Qiagen). The kits mentioned above were used according to manufacturer protocols.
-
bioRxiv - Physiology 2023Quote: ... A one-step real-time quantitative polymerase chain reaction (RT-qPCR) was performed using a QuantiFast SYBR Green RT-PCR one-step kit on a Rotorgene 3000Q thermocycler (Qiagen, UK). Each reaction was setup as follows ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 katna1-/-MZ and one pool of 10 wild-type embryos (at 24 hpf) using the RNeasy Mini-kit (Qiagen, France) and reverse-transcribed using the Superscript RT II Kit with random hexamers (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2024Quote: We extracted DNA from one of the two duplicate swabs using a modified version of the DNeasy® Blood and Tissue kit (QIAGEN) optimized to recover DNA from swabs ...
-
bioRxiv - Microbiology 2023Quote: Total DNA was isolated from the whale blow and technical control samples in one batch using a QIAamp DNA Mini Kit (QIAGEN, Germany). The primers used for sequencing the 16SrRNA V3 and V4 regions were 341F (5’-CCTACGGGNGGCWGCAG ...
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Developmental Biology 2023Quote: DNA from two separate stage 42 embryos of F0 Cab and F0 Kaga and one stage 42 embryo of F1 hybrid Kaga/Cab was extracted using DNeasy Blood and Tissue Kit (Qiagen #69504) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were seeded at 3 × 105 cells.well−1 in 6-well plates and transfected 24 h later with one pmiRGLO derivative construct per well (0.9 µg plasmid) using Effectene (Qiagen cat. #301425). After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat ...
-
bioRxiv - Neuroscience 2023Quote: ... One well of a 60-80% confluent 12-well was harvested with 700 μl QIAzxol Lysis Reagent (Qiagen; Cat. No. 79306) for subsequent RNA extraction with RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... acinar cells of Ptf1aERT;K* and Ptf1aERT;K*;Ror2f/f mice were isolated one week after Tamoxifen administration and genomic DNA was isolated using the DNeasy® Blood and Tissue Kit (69504, Qiagen). PCR was performed using the Go TaqTM Master Mix (PRM7123 ...
-
bioRxiv - Plant Biology 2024Quote: ... Colony PCR was performed with KOD One™ PCR Master Mix (Toyobo) to screen colonies before recovering plasmids with a 5 mL overnight culture and miniprep (QIAgen).
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...