Labshake search
Citations for Qiagen :
1651 - 1700 of 2160 citations for Recombinant Human IIntercellular Adhesion Molecule 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated with Angiotensin-II (1 μM) alone or in combination with DAPT (10 μM) or siNotch1 (Qiagen) (50 nM ...
-
bioRxiv - Plant Biology 2023Quote: ... Leaf discs were ground in 1 mL sterile water with the help of a tissue lyser (QIAGEN, TissueLyser II) using 1.5 mL safe-lock Eppendorf tubs containing three 2.4 mm metal beads ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was isolated from 1 × 106 BMDM from WT or p38γ/δKIKO male mice using the RNeasy kit (QIAGEN). Biological replicate libraries were prepared using the TruSeq RNA library prep kit (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were harvested by centrifugation (2500 x g, 3.5 min) and washed with 1 mL of RNAse-free water (Qiagen) before being spun down (10k rpm ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified bacterial lysates from a 1 l culture were bound to a 0.5 ml column of Ni-NTA resin (Qiagen) by gravity flow ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted by incubation with 6 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, 1% SDS, 0.1 mg/ml proteinase K (Qiagen, 19131)) at 55°C for 16 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... V2 and V3 amplicons were resolved in the 1% agarose gel and purified using the gel purification kit (Qiagen). Each cDNA was cloned into pDONR201 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA (gDNA) was extracted from J-Lat cells 10.6 and HIV-1 negative CD4+ T cells with the QIAcube (Qiagen), using the QiaAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Rainbow proviral HIV-1 DNA dPCR assay was performed on a QIAcuity Four digital PCR platform (Qiagen, Germany) with at least 500 ng (CD4+ T cell ...
-
bioRxiv - Immunology 2023Quote: ... and approximately 1 µg of isolated RNA was converted to cDNA using RT2 First Strand Kit (Qiagen, Hilden, Germany). cDNA was diluted (1:10 ...
-
bioRxiv - Systems Biology 2023Quote: ... Large fragments (200-400 bp) were extracted from a 1% agarose gel with QIAquick Gel Extraction Kit (Qiagen, Netherlands). The final library was sequenced as 85 bp long single-end reads on a NextSeq™ 550 (Illumina ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Developmental Biology 2023Quote: Blastocysts were washed with DPBS containing 1 mg/ml polyvinylpyrrolidone (PBS-PVP) and transferred into 50 μl droplets of 0.1% protease (Qiagen) to remove the zona pellucida ...
-
bioRxiv - Bioengineering 2023Quote: ... total RNA was extracted from about 1 × 106 cells from all groups using RNeasy Mini Kit (Qiagen, Valencia, CA), then using the random hexamer primer and M-MuLV reverse transcriptase kit (Fermentas ...
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Immunology 2023Quote: The post-caval lobe of the lung was weighed and homogenized in 1 mL of PBS (pH 7.4) using a TissueLyser LT (Qiagen). RNA was extracted using TRIzol™ LS Reagent (Invitrogen ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Genomics 2023Quote: ... After overnight proteinase K digestion in Lysis Buffer (BNG) and 1-hour treatment with RNAse A (Qiagen, MD,USA), plugs were washed 4 times in 1×Wash Buffer (BNG ...
-
bioRxiv - Genomics 2023Quote: ... 1×106 cells were harvested from each culture and DNA was extracted using QIAamp DNA mini Kit (QIAGEN 51304). STR analysis was performed with PowerPlex 21 System (Promega DC8902 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9-10 mL of Buffer BB (1/3 of the lysate volume, From QIAGEN Plasmid Plus Midi Kit) was added ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then washed with 1× PBS and treated with 100 μg/mL of RNase A (Qiagen, USA) followed by staining with 50 μg/mL of propidium iodide (Sigma-Aldrich ...
-
bioRxiv - Genomics 2024Quote: ... 72 °C for 1 min and then subjected to a 1.2x SPRI cleanup eluting in 42 µl EB buffer (Qiagen). Each sample was split into two fractions and each of them was further amplified with modality-specific primers ...
-
bioRxiv - Microbiology 2024Quote: ... Material was ruptured two times for 1 min at 30 Hz in a TissueLyser (Qiagen Inc., Germantown, MD, USA). Between and after these two steps of tissue disruption ...
-
bioRxiv - Genomics 2024Quote: ... Homogenization buffer for RNA purification was made by adding 1:100 beta-mercaptoethanol to Buffer RLT (Qiagen, Valencia, CA) and kept on ice until use ...
-
bioRxiv - Cell Biology 2023Quote: Undifferentiated myoblasts (day 0) and differentiated myotubes (day 7) were collected and lysed in 1 mL of Qiazol (Qiagen). RNA from undifferentiated and differentiated myoblasts was extracted using the Qiagen miRNeasy kit (Qiagen ...
-
bioRxiv - Bioengineering 2023Quote: Each body part (legs and thorax) was homogenized individually for 3 × 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The lysate was centrifuged at 50,000×g for 10 min and to the supernatant 1 mL of 50% Ni−NTA (Qiagen) was added and incubated for 1 h at 4 °C ...
-
bioRxiv - Immunology 2024Quote: Total RNA from roughly 1-3 million thawed patient PBMCs was extracted using a RNeasy Mini Extraction kit (Qiagen) and reverse transcribed to cDNA using oligo-DT primers and the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... doxycycline was added at (0.1 μg/ml, 1 μg/ml (CHRDL2 +) or 10 μg/ml (CHRDL2 ++) RNA was extracted (RNeasy, QIAGEN) and quantified by real-time reverse transcriptase polymerase chain reaction (qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... We immediately transferred all swabs and film to a microcentrifuge tube with 1 mL lysis buffer and garnet homogenization beads (Qiagen NV ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µM A740003 or both BzATP and A740003 together (A740003 was pre incubated for 1 h before adding BzATP) 24 hours later RNA was extracted using the miRNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was extracted from 1 B6 and two Card19lxcn BMDMs derived from three independent mice using a DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: CIRCLE-seq libraries were prepared for each gRNA (IDT) using genomic DNA extracted from NHGRI-1 (DNA Blood & Tissue kit, Qiagen) following the described protocol [59] ...
-
bioRxiv - Microbiology 2020Quote: ... We sampled 1 ml of the clear phase for living planktonic cells and extracted DNA using DNeasy Blood & Tissue Kit (Qiagen). The cultures were also plated on SHIEH-agar plates with dilutions for cfu/ml -estimation and colony-PCR.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The tissue was ground to a fine powder by adding 10-15 zirconia beads (1 mm diameter) and using a TissueLyser (Qiagen) for sunflower ligules ...
-
bioRxiv - Genomics 2020Quote: PCR amplicons verified by 1% agarose gel electrophoresis were purified from gel using Gel extraction kit (Qiagen GmbH, Hilden, Germany) and ligated into a pGEM-T easy cloning vector (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from cavin1a/1b DKO and WT zebrafish embryos (> 100 embryos randomly selected from 1 clutch) using the RNeasy Mini Kit (QIAGEN) and cDNA synthesis was performed using SuperscriptIII reverse transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNA was isolated from 1×106 BMMCs that were untreated or treated with IgE receptor crosslinking using the RNeasy mini kit (Qiagen). RNA was treated with DNase I according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmids containing qPCR amplicon sequences were linearized by digestion with SmaI for 1 h and purified using the QIAquick PCR purification kit (Qiagen). Linearized plasmids were quantified using spectrophotometry ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen), for 5 min at 50 Hz ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...