Labshake search
Citations for Qiagen :
1651 - 1700 of 3281 citations for Fipronil 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 0.3 µL 20mg/mL protease (Qiagen), and nuclease-free water in a total volume of 6 µL for 3 hours at 50 C ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 125 U/ml DNAse (Qiagen) and incubated on ice with mixing by pipet ...
-
bioRxiv - Microbiology 2022Quote: ... 500 mL of Buffer AW1 (Qiagen) was added to the spin columns which were then centrifuged at 6,000 x g (22°C ...
-
bioRxiv - Microbiology 2022Quote: ... 500 mL of Buffer AW2 (Qiagen) was added to the spin columns which were then centrifuged at 20,000 x gf (22°C ...
-
bioRxiv - Microbiology 2022Quote: ... 40 mL of AE Buffer (Qiagen) was added directly onto the spin column membrane and let incubate at room temperature for 1 min prior to centrifugation at 6,000 x g (22°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.25 µg/ml protease (Qiagen, 19155) as final concentration in nuclease-free water (Ambion ...
-
bioRxiv - Bioengineering 2023Quote: Protease K (20 mg/ml) (Qiagen) was added to DirectPCR Lysis Reagent (Viagen Biotech Inc. ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.1 mg/ml RNase A (QIAGEN), and 10% glycerol ...
-
bioRxiv - Microbiology 2021Quote: ... 100 µL of washed magnetic beads (BioMag Protein A, Qiagen, Hilden, Germany) resuspended in 100 µL TN-buffer were added to each sample (total volume of 750 µL ...
-
bioRxiv - Genomics 2020Quote: ... total gDNA was obtained from tissue using Genomic-tip 100/G (Qiagen) for the spotty (Notolabrus celidotus) ...
-
bioRxiv - Genomics 2019Quote: DNA was isolated using Qiagen Genomic-tip 100/G (Qiagen, Hilden Germany) according to the instructions of the manufacturer ...
-
bioRxiv - Immunology 2019Quote: ... Attached DNA was eluted with 100 μl of Buffer EB (Qiagen, 19086) and quantified with QubitTM dsDNA Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... the reactions were incubated with 100 μL of Ni2+-NTA Sepharose (Qiagen) in a spin column to trap the YpetTEV-Ub Ubn and remove other reaction components ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1% Triton X-100 and homogenized in a TissueLyser II (Qiagen), centrifuged at 20,000 rcf at 4°C for 10 minutes after which the supernatant was collected for multiplexed immunoassay analyses.
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Bioengineering 2020Quote: ... The supernatant was mixed with 100 μL of Ni-NTA resin (Qiagen) to a 50 mL falcon tube ...
-
bioRxiv - Bioengineering 2020Quote: ... The supernatant was mixed with 100 μL of Ni-NTA resin (Qiagen) to a 50 mL falcon tube ...
-
bioRxiv - Pathology 2022Quote: ... 200 μL of H2O and 100 μg RNAse A (QIAGEN, Hilden, Germany) were added before incubating for 1 hr at 65 °C ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA (100 ng) was extracted from sorted OCLs (RNeasy kit, Qiagen) and directional libraries were prepared (Truseq stranded total RNA library kit ...
-
bioRxiv - Pathology 2019Quote: ... 100 ng of gDNA extracted using QIAamp DNA Blood Mini Kit (Qiagen) was used in each assay.
-
bioRxiv - Biochemistry 2021Quote: ... resuspended in 100 μL PBS containing 0.1 μg anti-penta·His antibody (Qiagen) and 1 μg streptavidin allophycocyanin (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... added to 100 μl washed Ni-NTA agarose nickel beads slurry (Qiagen), and transferred to Snap Cap spin columns (Pierce).
-
bioRxiv - Plant Biology 2022Quote: ... The supernatant was poured onto an equilibrated Genomic Tip 100 (Qiagen, Germany). Afterwards the Genomic Tip 100 was washed twice with 7.5 mL QC Buffer (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Microbiology 2022Quote: ... 100 ng RNA per well was transfected using HiPerFect Transfection Reagent (QIAGEN) according to the manufacturer’s protocol for 6 h in the presence of the depicted inhibitor concentrations.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatants were mixed with Ni-NTA Superflow resin (100 μl) (QIAGEN) and incubated at 4°C overnight ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA was isolated using the Genomic-tip 100/G columns (Qiagen) according to “Protocol ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... precipitated in isopropanol and resuspended in 100 μL of Buffer EB (Qiagen). Inverse PCRs were performed on the BglII-NlaIII fragments on the HBV genome using with inverse PCR primers tgccttctgacttctttccttcagt and cagtagctccaaattctttataaggg ...
-
bioRxiv - Molecular Biology 2024Quote: ... and was resuspended in 100 uL elution buffer (buffer EB, QIAgen, 19086). DNA was further purified and concentrated by Zymo Clean and Concentrator Kit (ZymoResearch ...
-
bioRxiv - Systems Biology 2020Quote: ... The biopsies were transferred into Eppendorf Safe-Lock Microtube 2.0 ml with 1.5 ml RNAlater (76154, Qiagen), and kept at room temperature for minimum two hours ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 μL sample) were run in duplicates in a Rotor-Gene Q machine (QIAGEN) using the appropriate primer pairs.
-
bioRxiv - Neuroscience 2021Quote: ... and 4 were resuspended each in 117 µL of Lysis Buffer RLT Plus (Qiagen), vortexed ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C until DNA preparation using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacture’s recommendation ...
-
bioRxiv - Microbiology 2022Quote: ... the Qiagen MagAttract PowerSoil DNA Isolation Kit (Cat#: 27000-4-KF; Qiagen, Carlsbad, CA), against five other extraction kits ...
-
bioRxiv - Microbiology 2019Quote: DNA isolation was performed using the MagAttract PowerSoil DNA Kit (Qiagen, # 27100-4-EP) on Eppendorf epMotion 5075 liquid handlers following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and purified with the MiniElute PCR purification kit (QIAGEN, Cat. No. / ID: 28006×4). The purified genomic DNA fragments were end-repaired and had an A-tail added to the 3’ end ...
-
bioRxiv - Molecular Biology 2020Quote: ... thaliana were homogenised with zirconia beads YTZ-4 and TissueLyser II (Qiagen, Hilden, Germany), and total RNA was then extracted using the Maxwell 16 LEV Plant RNA Kit (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Neuroscience 2023Quote: ... and tissue was homogenized at 4°C in a tissue lyser bead mill (Qiagen) for 2 min at 20 Hz ...
-
bioRxiv - Biophysics 2023Quote: ... for 4 h at 37 °C and purified with RNeasy Mini Kit (Qiagen; #74104). Following the in vitro transcription ...
-
bioRxiv - Biophysics 2023Quote: ... 4 °C and the supernatant was loaded onto a NiNTA column (Qiagen, Hilden, Germany) previously equilibrated with washing buffer (20 mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lysates were treated with 4 μl of Qiagen protease (QIAGEN, Hilden, Germany, #1017782,) at 56°C for 10 min ...
-
bioRxiv - Immunology 2023Quote: ... Larvae were euthanized at 4°C overnight and homogenized with a tissue lyser (Qiagen) at 1800 oscillations/min (30 Hz ...
-
bioRxiv - Bioengineering 2024Quote: ... and was then subjected to Ni-NTA affinity purification at 4 [(Qiagen, Valencia, CA). The column was adequately washed with 20 column volume of wash buffer containing 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Physiology 2022Quote: ... approximately 100 mg of adipose tissue and a 7 mm metal bead were placed in a 2 mL centrifuge tube containing 0.5 mL PBS buffer (pH 7.4) and homogenised in TissueLyser II (Qiagen) for 2 minutes at 25 Hz ...