Labshake search
Citations for Qiagen :
1601 - 1650 of 1864 citations for C Type Lectin Domain Family 2 Member B CLEC2B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... up to 200 mg of tissue was disrupted in TRIzol (Lifetechnologies) with 2 x 5 mm stainless steel beads using the TissueLyser (Qiagen) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA concentration and purity were measured by a spectrophotometer and 2 ug were used to synthesize cDNA by QuantiTect Reverse Transcription kit (Qiagen). Real-time amplification was performed in a Mastercycler EP Realplex (Eppendorf ...
-
bioRxiv - Microbiology 2021Quote: ... Mosquito bodies and legs and wings were put into a 2 ml round-bottom tubes containing 250 ml of PBS and a steel ball (Qiagen). Samples were homogenized using a TissueLyser (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... in Tris/HCl/Ca+2 buffer was subjected to extraction in house using the silica method or QIAamp viral RNA mini kit (Qiagen) according to the manufacturer’s guidelines.
-
bioRxiv - Molecular Biology 2021Quote: ... The specimens were gently and quickly homogenized using a BioMasher II homogenizer (Funakoshi) and mixed with 2 mL of Buffer G2 (QIAGEN), including 200 µg/mL RNase A and 50 µL proteinase K (20 mg/mL) ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50uL of the dounce homogenized sample was labelled as “input” and added to 350uL RLT buffer with 1% 2-mercaptoethanol (Qiagen), followed by RNA extraction ...
-
bioRxiv - Immunology 2021Quote: ... Amplification was confirmed by running samples on a 2% agarose gel prior to PCR Clean up (QiaQuick PCR Purification kit, Qiagen). Samples were Sanger sequenced (Source Bioscience ...
-
bioRxiv - Immunology 2021Quote: Viral RNA was isolated from rhesus macaque plasma from 2 weeks post-SIV infection using an Ultrasense Viral RNA kit (QIAGEN) and cDNA was reverse transcribed using the Applied Biosystems High Capacity cDNA synthesis kit (Thermo-Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed with a primer set targeting partial regions of the ORF1b gene in the SARS-CoV-2 virus using the QIAGEN OneStep RT-PCR kit (Qiagen) as previously reported (51) ...
-
bioRxiv - Genetics 2021Quote: ... frozen and lyophilised in a 2 ml 96 deep-well plate following which the samples were ground in the TissueLyser II (QIAGEN) using a steel ball in each well for 4-6 minutes at a frequency of 25 Hz ...
-
bioRxiv - Genetics 2019Quote: ... in each well of 8-stripped PCR tubes by shaking with a zirconia bead (2 mm in diameter, Nikkato, Japan) in TissuLyser II (Qiagen) for 30 s at 30 Hz ...
-
bioRxiv - Genetics 2019Quote: ... A 5 ul sample was analyzed by electrophoresis on 2% agarose gel and appropriately-digested samples were first purified by PCR purification kit (Qiagen), eluted with 50 ul of 1x NEB Buffer 3 and treated with 10 units of CIP (NEB ...
-
bioRxiv - Genomics 2020Quote: ... aseptic LS007 shoot tissue was ground under liquid nitrogen using a mortar and pestle and resuspended in 2 mL of AP1 (Qiagen) with 20 µl of RNase I (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... and Consensus Sequence generation RNA was extracted from eight respiratory samples positive for SARS-CoV-2 using the QIAmp Viral RNA Mini kit (Qiagen). Sequencing was performed as described previously (11) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR products with sizes from 150 bp to 300 bp were extracted from 2% agarose gel using MinElute Gel Extraction Kit (Qiagen).
-
bioRxiv - Biochemistry 2021Quote: ... and early stationary phase (OD = 1.0-1.3).1 mL sample of each culture was directly transferred to 2 mL RNAprotect cell reagent (Qiagen, Hilden, Germany). The samples were vortexed 5 sec ...
-
bioRxiv - Developmental Biology 2022Quote: ... run on a 2% agarose gel and a band of 300bp approximately was cut and gel purified using QIAquick Gel Extraction Kit (QIAGEN). Library concentration was determined with KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... mosquitoes were homogenized in 1.7 mL tubes with 50 μL of water and approximately ten 1.0 mm diameter zirconia beads (Thistle Scientific 11079110zx) by shaking at 30 Hz for 2 minutes in a Tissue Lyzer II homogenizer (Qiagen). DNA was extracted using a PureLink Genomic DNA Mini kit (Thermofisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... 32 μl Master Mix containing 30 μl MDA reaction buffer and 2 μl Phi29 polymerase (REPLI-g UltraFast Mini Kit; Qiagen) were added ...
-
bioRxiv - Genomics 2022Quote: ... RNA (3 replicates each of V or E2 treated samples from donor 1 and donor 2) was DNAse treated and cleaned up using the RNeasy Mini kit (Qiagen) or the RNA Clean and Concentrator 5 kit (Zymo ...
-
bioRxiv - Microbiology 2022Quote: ... The tubes were weighed again (wa) after sample collection and the samples were homogenized for 2 min at 25 Hz using a TissueLyser from Qiagen. At 4 d.p.i ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was extracted from 2 mm root tips of 5 DAG seedlings using the RNeasy Plus Micro Kit (cat. No. 74034 QIAGEN). Prior to cDNA synthesis ...
-
bioRxiv - Physiology 2022Quote: Assessment of differential expression was conducted on the mapped reads of the 2 previously mentioned pipelines using 2 methods for comparison: the EDGE method with default settings in CLC Genomics Workbench 12 (QIAGEN) and EdgeR (version 3.34.0) ...
-
bioRxiv - Neuroscience 2022Quote: ... Pathway analysis was performed for genes 2-fold up- or down-regulated with p-value < 0.05 using Ingenuity Pathway Analysis (IPA) software (Qiagen, USA).
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 RNA from cell culture supernatant samples was isolated using AVL buffer and the QIAamp Viral RNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: 2 × 109 cells pretreated with TRIzol reagent were used for preparing RNA reference materials using RNeasy Maxi kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... commercially available cDNAs originating from various human tissues were purchased from TaKaRa (detailed sample information is given in Table S3) and 2 ng of cDNA were subjected to quantitative PCR (qPCR) analysis (Rotor-Gene Q, Qiagen), as recommended by the manufacturers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: SARS-CoV-2 RNA from cell culture supernatant samples was isolated using AVL buffer and the QIAamp Viral RNA Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Pathology 2023Quote: ... DNA was extracted after routine paraffin embedding (2 sections of 20 μm per sample) from 10 canine tumors (DNeasy Blood & Tissue Kit, Cat. No.69504, Qiagen; Veterinary Science Dept ...
-
bioRxiv - Neuroscience 2023Quote: ... ATAC-seq libraries were resolved on 2% agarose gels and fragments ranging in size from 100bp-1Kbp were excised and purified (Qiagen Minelute Gel Extraction Kit – Qiagen Cat#28604) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were transferred from DNA/RNA Shield – Lysis Tube to a 2 ml eppendorf and cells lysed using a TissueLyser II (Qiagen) at maximum speed (5 repetitions of 1 min with 1 min on ice between each) ...
-
bioRxiv - Genomics 2023Quote: ... the eluted DNA samples were run on a 2% agarose gel and the 280bp band purified using the QIAquick Gel extraction kit (QIAGEN). Illumina libraries were generated from 10 ng of DNA ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Approximately 1 μg of small RNAs in 8.5 μl were incubated with 2 μl of QIAseq FastSelect –rRNA Yeast Kit (Qiagen, #334215) at 75°C ...
-
bioRxiv - Immunology 2023Quote: Purified CD4+FYP+ Treg cells were stimulated with Cell Stimulation Cocktail (eBioscience) for 2 hrs and lysed in RLT buffer (Qiagen) containing 1% 2-mercaptoethanol (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Crystals were grown at 30°C by the hanging drop vapor diffusion method using 2 μL sample drops and 300 μL crystallization solution in a sealed chamber (EasyXtal 15-Well Tool, Qiagen). Crystals were soaked for 1h (for the Na structure or with the dibromo Intronistat B derivative ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The supernatant was then purified using a modified PB buffer and eluted using 2 washes in 18 μl buffer EB (QIAGEN) - with 3 min of incubation time at 37°C (Dabney et al ...
-
bioRxiv - Genetics 2023Quote: ... Whole blood was collected in 2% SDS Queens lysis buffer [23] and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen). All research was approved by the Institutional Animal Care and Use Committee at Columbia University (AC-AAAW6451) ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from 2 h and 10 h RPMI-grown and macrophage-internalized Cg cells using the RNeasy kit (Qiagen), followed by DNase I digestion ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... RNA from CD4+ T cells (2×106 cells per condition) was extracted by using the RNeasy Plus Mini kit (QIAGEN). Extracted total RNA was quantified using the Qubit broad range RNA assay ...
-
bioRxiv - Neuroscience 2024Quote: ... with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and TissueRuptor II (Qiagen) homogenization ...